Transcript: Mouse XM_006515020.3

PREDICTED: Mus musculus Rho-associated coiled-coil containing protein kinase 2 (Rock2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rock2 (19878)
Length:
6481
CDS:
230..4039

Additional Resources:

NCBI RefSeq record:
XM_006515020.3
NBCI Gene record:
Rock2 (19878)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515020.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425915 TACACTCCATGGGCTTAATAC pLKO_005 486 CDS 100% 13.200 18.480 N Rock2 n/a
2 TRCN0000421639 ATGAGTGCAGCAGCTATTAAA pLKO_005 2903 CDS 100% 15.000 10.500 N Rock2 n/a
3 TRCN0000424241 CAGAAGTGCAAATCTATTAAT pLKO_005 1274 CDS 100% 15.000 10.500 N Rock2 n/a
4 TRCN0000022923 CCCATGGATCAGAGATAATTA pLKO.1 1776 CDS 100% 15.000 10.500 N Rock2 n/a
5 TRCN0000022922 GCATCTCTTGAAGAAACAAAT pLKO.1 2777 CDS 100% 13.200 9.240 N Rock2 n/a
6 TRCN0000435967 TGACACAACAGATGATCAAAT pLKO_005 3102 CDS 100% 13.200 9.240 N Rock2 n/a
7 TRCN0000022921 CCCTGCAAAGTTTATTATGAT pLKO.1 3812 CDS 100% 5.625 3.938 N Rock2 n/a
8 TRCN0000022920 GCTGGAAATTACCCTTACCAA pLKO.1 2614 CDS 100% 3.000 2.100 N Rock2 n/a
9 TRCN0000000978 GCACAGTTTGAGAAGCAGCTA pLKO.1 2924 CDS 100% 2.640 1.848 N ROCK2 n/a
10 TRCN0000342474 GCACAGTTTGAGAAGCAGCTA pLKO_005 2924 CDS 100% 2.640 1.848 N ROCK2 n/a
11 TRCN0000179092 CATGGACAAGAAGGAAGAGTA pLKO.1 3784 CDS 100% 4.950 3.465 N BCAP31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515020.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11371 pDONR223 100% 50% 53.8% None (many diffs) n/a
2 ccsbBroad304_11371 pLX_304 0% 50% 53.8% V5 (many diffs) n/a
3 TRCN0000480037 GGCGCATCGACCGGGCATATTCTC pLX_317 20% 50% 53.8% V5 (many diffs) n/a
Download CSV