Transcript: Mouse XM_006516220.3

PREDICTED: Mus musculus G patch domain containing 2 like (Gpatch2l), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpatch2l (70373)
Length:
1766
CDS:
118..1359

Additional Resources:

NCBI RefSeq record:
XM_006516220.3
NBCI Gene record:
Gpatch2l (70373)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516220.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271894 GATACCATGGTCGTCTGAATA pLKO_005 1022 CDS 100% 13.200 18.480 N Gpatch2l n/a
2 TRCN0000284560 CCCGGATTCACTGTCCATAAC pLKO_005 889 CDS 100% 10.800 7.560 N Gpatch2l n/a
3 TRCN0000201676 GCTGTGTCTTTGTTCCTGAAA pLKO.1 1724 3UTR 100% 4.950 3.465 N Gpatch2l n/a
4 TRCN0000190470 GAAAGTGTCAGATTGGAGCTA pLKO.1 558 CDS 100% 2.640 1.848 N Gpatch2l n/a
5 TRCN0000189748 GAGTCTGACTCCTTTACGGAA pLKO.1 454 CDS 100% 2.640 1.848 N Gpatch2l n/a
6 TRCN0000202063 CTTTCCTAAGCCAACCAGGAA pLKO.1 692 CDS 100% 0.264 0.185 N Gpatch2l n/a
7 TRCN0000271932 TGCCAAGAAGCAGCGTCTATC pLKO_005 603 CDS 100% 10.800 6.480 N Gpatch2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516220.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12245 pDONR223 100% 73.1% 74.1% None (many diffs) n/a
2 ccsbBroad304_12245 pLX_304 0% 73.1% 74.1% V5 (many diffs) n/a
3 TRCN0000479474 ACTTCGACCGCAATTTACCACCCC pLX_317 29.4% 73.1% 74.1% V5 (many diffs) n/a
Download CSV