Transcript: Mouse XM_006517252.1

PREDICTED: Mus musculus G protein-coupled receptor kinase 6 (Grk6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grk6 (26385)
Length:
2178
CDS:
151..1125

Additional Resources:

NCBI RefSeq record:
XM_006517252.1
NBCI Gene record:
Grk6 (26385)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517252.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361581 GAACAGTTCTCTACAGTTAAA pLKO_005 796 CDS 100% 13.200 10.560 N Grk6 n/a
2 TRCN0000361580 CCATGGCTCTCAACGAGAAAC pLKO_005 48 5UTR 100% 10.800 7.560 N Grk6 n/a
3 TRCN0000022853 TCTTGGAGAAAGTGAACAGTA pLKO.1 72 5UTR 100% 4.950 3.465 N Grk6 n/a
4 TRCN0000022851 CGAGAAACAGATCTTGGAGAA pLKO.1 61 5UTR 100% 4.050 2.835 N Grk6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517252.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06322 pDONR223 100% 49% 52.2% None (many diffs) n/a
2 ccsbBroad304_06322 pLX_304 0% 49% 52.2% V5 (many diffs) n/a
3 TRCN0000479803 TGAGACGCGACATGGTATATCCAG pLX_317 20.5% 49% 52.2% V5 (many diffs) n/a
4 ccsbBroadEn_14658 pDONR223 0% 49% 52.2% None (many diffs) n/a
5 ccsbBroad304_14658 pLX_304 0% 49% 52.2% V5 (many diffs) n/a
6 ccsbBroadEn_00682 pDONR223 100% 47% 48.5% None (many diffs) n/a
7 ccsbBroad304_00682 pLX_304 0% 47% 48.5% V5 (many diffs) n/a
8 TRCN0000480454 ACTTTTCCCGCTTGTCCTGCCCCC pLX_317 24.5% 47% 48.5% V5 (many diffs) n/a
Download CSV