Transcript: Mouse XM_006517467.3

PREDICTED: Mus musculus multiple C2 domains, transmembrane 1 (Mctp1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mctp1 (78771)
Length:
6570
CDS:
428..3244

Additional Resources:

NCBI RefSeq record:
XM_006517467.3
NBCI Gene record:
Mctp1 (78771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028270 CCGGAATGTACCAGTTGGATA pLKO.1 1194 CDS 100% 4.950 3.960 N Mctp1 n/a
2 TRCN0000028221 GCTGCTTCTAAGAAACTTTAT pLKO.1 2560 CDS 100% 13.200 9.240 N Mctp1 n/a
3 TRCN0000028249 CCACTGAGATACATTGTTCTT pLKO.1 3047 CDS 100% 4.950 3.465 N Mctp1 n/a
4 TRCN0000028295 GCAATTTGATTTCCATCTCTA pLKO.1 1801 CDS 100% 4.950 3.465 N Mctp1 n/a
5 TRCN0000002072 TGGGACAAAGATGCTGGGAAA pLKO.1 1856 CDS 100% 4.050 2.835 N MCTP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12614 pDONR223 100% 47.5% 48.5% None (many diffs) n/a
2 ccsbBroad304_12614 pLX_304 0% 47.5% 48.5% V5 (many diffs) n/a
3 TRCN0000475853 AGTACGTAGGGAACCGATAACAAA pLX_317 17% 47.5% 48.5% V5 (many diffs) n/a
Download CSV