Construct: ORF TRCN0000475853
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013682.1_s317c1
- Derived from:
- ccsbBroadEn_12614
- DNA Barcode:
- AGTACGTAGGGAACCGATAACAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MCTP1 (79772)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475853
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_017009865.2 | 82.6% | 81.7% | (many diffs) |
| 2 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_017009856.1 | 76.9% | 75.8% | (many diffs) |
| 3 | human | 79772 | MCTP1 | multiple C2 and transmembra... | NM_001002796.3 | 76.8% | 75.7% | (many diffs) |
| 4 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_017009859.1 | 75.4% | 74.7% | (many diffs) |
| 5 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_005272082.5 | 75.3% | 74.2% | (many diffs) |
| 6 | human | 79772 | MCTP1 | multiple C2 and transmembra... | NM_001297777.1 | 74.3% | 73.7% | (many diffs) |
| 7 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_017009860.1 | 73.4% | 72.3% | (many diffs) |
| 8 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_011543649.3 | 71.9% | 70.8% | (many diffs) |
| 9 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_005272090.4 | 70.9% | 69.8% | (many diffs) |
| 10 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_017009855.2 | 70.2% | 69.1% | (many diffs) |
| 11 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_017009863.1 | 69.2% | 68.1% | (many diffs) |
| 12 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_017009857.1 | 68.5% | 67.5% | (many diffs) |
| 13 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_006714692.4 | 67.9% | 66.8% | (many diffs) |
| 14 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_017009858.2 | 66.9% | 65.8% | (many diffs) |
| 15 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_017009861.2 | 66% | 64.9% | (many diffs) |
| 16 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_017009864.2 | 66% | 64.9% | (many diffs) |
| 17 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_017009862.2 | 64.3% | 63.2% | (many diffs) |
| 18 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XM_011543650.2 | 61.6% | 60.6% | (many diffs) |
| 19 | human | 79772 | MCTP1 | multiple C2 and transmembra... | NM_024717.5 | 58.2% | 57.2% | (many diffs) |
| 20 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XR_001742266.1 | 38% | (many diffs) | |
| 21 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XR_001742267.1 | 37.1% | (many diffs) | |
| 22 | human | 79772 | MCTP1 | multiple C2 and transmembra... | XR_001742264.2 | 33.3% | (many diffs) | |
| 23 | mouse | 78771 | Mctp1 | multiple C2 domains, transm... | XM_017315644.1 | 67.6% | 69.9% | (many diffs) |
| 24 | mouse | 78771 | Mctp1 | multiple C2 domains, transm... | XM_006517469.3 | 66.1% | 68% | (many diffs) |
| 25 | mouse | 78771 | Mctp1 | multiple C2 domains, transm... | XM_006517468.3 | 64.8% | 66.6% | (many diffs) |
| 26 | mouse | 78771 | Mctp1 | multiple C2 domains, transm... | XM_006517471.3 | 62.2% | 64.4% | (many diffs) |
| 27 | mouse | 78771 | Mctp1 | multiple C2 domains, transm... | XM_006517470.3 | 60.8% | 63.2% | (many diffs) |
| 28 | mouse | 78771 | Mctp1 | multiple C2 domains, transm... | NM_030174.2 | 59.8% | 62.6% | (many diffs) |
| 29 | mouse | 78771 | Mctp1 | multiple C2 domains, transm... | XM_006517466.3 | 51.9% | 52.6% | (many diffs) |
| 30 | mouse | 78771 | Mctp1 | multiple C2 domains, transm... | XM_006517463.3 | 50.5% | 51.2% | (many diffs) |
| 31 | mouse | 78771 | Mctp1 | multiple C2 domains, transm... | XM_006517462.3 | 49.7% | 50.4% | (many diffs) |
| 32 | mouse | 78771 | Mctp1 | multiple C2 domains, transm... | XM_017315643.1 | 49.6% | 50.6% | (many diffs) |
| 33 | mouse | 78771 | Mctp1 | multiple C2 domains, transm... | XM_017315642.1 | 48.7% | 49.8% | (many diffs) |
| 34 | mouse | 78771 | Mctp1 | multiple C2 domains, transm... | XM_006517464.3 | 47.9% | 49% | (many diffs) |
| 35 | mouse | 78771 | Mctp1 | multiple C2 domains, transm... | XM_006517467.3 | 47.5% | 48.5% | (many diffs) |
| 36 | mouse | 78771 | Mctp1 | multiple C2 domains, transm... | XM_006517472.3 | 42.2% | 42.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1866
- ORF length:
- 1800
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct agacagctgc aagctgaaaa gtgcctgcaa tttgccattt atttgtaata 121 agaaaataat aaacactgct ggaaccagta atgcagaagt ccccttggct gatcccggaa 181 tgtaccagct ggacattaca ttaagaaggg gtcaaagttt agctgctcga gatcgaggag 241 ggacgagtga tccatatgtg aagtttaaaa tcggaggaaa agaagttttt agaagtaaga 301 taatacacaa gaacctcaac cctgtgtggg aagaaaaagc ttgtattctg gttgatcatc 361 ttagggagcc attgtatata aaggtatttg actatgattt tggactacag gatgacttta 421 tgggctcagc ctttctggat ctgacacaat tggagttaaa caggcccaca gatgtgaccc 481 ttactctgaa agatcctcat tatcctgacc atgatcttgg aatcattttg ctctcagtca 541 tccttacccc taaagaagga gagtccaggg atgtgacaat gctaatgagg aagagttgga 601 aaagatcaag taaggaactt tcagaaaatg aagtggttgg atcttatttc tctgtgaagt 661 ctctcttttg gaggacgtgc ggcaggccag ctcttcctgt cctgggcttc tgcagagcag 721 agcttcagaa tccttattgc aaaaatgtac aatttcagac ccaaagttta cgcctatcag 781 acctacacag aaaatcgcat ctttggagag gaatagtcag catcaccttg attgaaggga 841 gagacctcaa ggccatggat tccaacgggt tgagcgatcc ctacgtgaag ttccggcttg 901 ggcatcagaa gtacaagagc aagattatgc caaaaacgtt gaatcctcag tggagggaac 961 aatttgattt tcacctttat gaagaaagag gaggagtcat tgatatcact gcatgggaca 1021 aagatgctgg gaaaagggat gatttcattg gcaggtgcca ggtcgacctg tcagccctca 1081 gtagggaaca gacgcacaag ctggagttgc agctggaaga gggtgaggga cacctggtgc 1141 tgctggtcac tctgacagca tcagccacag tcagcatctc tgacctgtct gtcaactccc 1201 tggaggacca gaaggaacga gaggagatat taaagaaata tagcccattg aggatatttc 1261 acaacctgaa agatgtggga tttctccagg tgaaagtcat cagagcggaa gggttaatgg 1321 ctgccgacgt cactggaaaa agtgacccat tttgtgtggt agaactgaac aacgatagac 1381 tgctaacaca tactgtctac aaaaatctca atcctgagtg gaataaagtc ttcacgttca 1441 acattaaaga tatccattca gttcttgaag tgacagttta tgatgaagat cgggatcgaa 1501 gtgctgactt tctgggcaaa gttgctatac cattgctgtc tattcaaaat ggtgaacaga 1561 aagccTACGT CTTGAAAAAC AAGCAGCTGA CAGGGCCAAC AAAGGGGGTC ATCTATCTTG 1621 AAATAGATGT GATTTTTAAT GCTGTGAAAG CCAGCTTACG AACATTAATA CCCAAAGAAC 1681 AGAAGTACAT TGAAGAGGAA AACAGACTCT CTAAACAGCT GCTACTAAGA AACTTTATCA 1741 GAATGAAACG TTGTGTCATG GTGCTGGTAA ATGCTGCATA CTACGTTAAT AGTTGCTTTG 1801 ATTGGGATTC ACCCCCAAGG AGTCTCGCTG CTTTTGTGGC CTTGTATGGG ACTTTCATTA 1861 ATGTCTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1921 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1981 CTTGGCTTTA TATATCTTGT GGAAAGGACG AAGTACGTAG GGAACCGATA ACAAAACGCG 2041 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt