Transcript: Mouse XM_006517642.3

PREDICTED: Mus musculus peptidylprolyl isomerase domain and WD repeat containing 1 (Ppwd1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppwd1 (238831)
Length:
2235
CDS:
1..1848

Additional Resources:

NCBI RefSeq record:
XM_006517642.3
NBCI Gene record:
Ppwd1 (238831)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517642.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101172 CGGTGATGATAAAGCGATGAA pLKO.1 360 CDS 100% 4.950 6.930 N Ppwd1 n/a
2 TRCN0000101171 GCACGAATATAAGTTCCCTAA pLKO.1 669 CDS 100% 4.050 5.670 N Ppwd1 n/a
3 TRCN0000000168 ACATGGAATTTGGCCGACGAA pLKO.1 917 CDS 100% 2.640 3.696 N PPWD1 n/a
4 TRCN0000429785 ATAACCAGCCACTTCATATTT pLKO_005 539 CDS 100% 15.000 10.500 N Ppwd1 n/a
5 TRCN0000436314 ATAACCAGCCACTTCATATTT pLKO_005 539 CDS 100% 15.000 10.500 N PPWD1 n/a
6 TRCN0000101170 GCACTAAATTGAGGCAAATAA pLKO.1 2062 3UTR 100% 15.000 10.500 N Ppwd1 n/a
7 TRCN0000425527 AGAGGATTTCTAACGTTAAAG pLKO_005 1766 CDS 100% 13.200 9.240 N Ppwd1 n/a
8 TRCN0000432519 AGGGTCTTTGATGAATCATTA pLKO_005 853 CDS 100% 13.200 9.240 N Ppwd1 n/a
9 TRCN0000432375 CCAACGCCTTGGCTTGATAAT pLKO_005 1699 CDS 100% 13.200 9.240 N PPWD1 n/a
10 TRCN0000436917 CCAACGCCTTGGCTTGATAAT pLKO_005 1699 CDS 100% 13.200 9.240 N Ppwd1 n/a
11 TRCN0000101173 GCTGGGCATTAAAGTAATAAA pLKO.1 1032 CDS 100% 15.000 9.000 N Ppwd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517642.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07877 pDONR223 100% 84.2% 88.1% None (many diffs) n/a
2 ccsbBroad304_07877 pLX_304 0% 84.2% 88.1% V5 (many diffs) n/a
3 TRCN0000469442 AGGGGGAGCGCTACCATCTCATTG pLX_317 20.9% 84.2% 88.1% V5 (many diffs) n/a
4 TRCN0000488931 TTCGGCTCCACCTACGGTCTATAA pLX_317 16.3% 84.2% 88.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV