Transcript: Mouse XM_006517737.3

PREDICTED: Mus musculus trafficking protein particle complex 13 (Trappc13), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trappc13 (66975)
Length:
2580
CDS:
545..1780

Additional Resources:

NCBI RefSeq record:
XM_006517737.3
NBCI Gene record:
Trappc13 (66975)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517737.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276992 CTACTTTGTTCACCAATATTC pLKO_005 609 CDS 100% 13.200 18.480 N Trappc13 n/a
2 TRCN0000276991 TCGAATTTCCATGATACTTAA pLKO_005 2256 3UTR 100% 13.200 18.480 N Trappc13 n/a
3 TRCN0000191483 GCCAATACTTATACTGCCTAA pLKO.1 1272 CDS 100% 4.050 3.240 N Trappc13 n/a
4 TRCN0000276993 GACGAGTTCTCAGCGTTTAAA pLKO_005 856 CDS 100% 15.000 10.500 N Trappc13 n/a
5 TRCN0000191305 CCTTTAAGATACCTGTCATTT pLKO.1 2003 3UTR 100% 13.200 9.240 N Trappc13 n/a
6 TRCN0000190018 GCTGGAAGACACCATTTGCTT pLKO.1 2227 3UTR 100% 3.000 2.100 N Trappc13 n/a
7 TRCN0000202198 CCAGAGGATATTTGCAGCCAA pLKO.1 1242 CDS 100% 2.640 1.848 N Trappc13 n/a
8 TRCN0000285811 CCAGAGGATATTTGCAGCCAA pLKO_005 1242 CDS 100% 2.640 1.848 N Trappc13 n/a
9 TRCN0000276936 TAATTGGGAAACTGGATATAG pLKO_005 1344 CDS 100% 13.200 7.920 N Trappc13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517737.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14277 pDONR223 100% 74.5% 28.4% None (many diffs) n/a
2 ccsbBroad304_14277 pLX_304 0% 74.5% 28.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000478019 GGCAGTGCACAACGAATTTGCACA pLX_317 46.4% 74.5% 28.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_12657 pDONR223 100% 54.7% 47.5% None (many diffs) n/a
5 ccsbBroad304_12657 pLX_304 0% 54.7% 47.5% V5 (many diffs) n/a
6 TRCN0000469574 ATCTAAATGTCAATTAGACAACCG pLX_317 63.8% 54.7% 47.5% V5 (many diffs) n/a
Download CSV