Transcript: Mouse XM_006518030.3

PREDICTED: Mus musculus Ca2+-dependent secretion activator (Cadps), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cadps (27062)
Length:
5722
CDS:
602..4714

Additional Resources:

NCBI RefSeq record:
XM_006518030.3
NBCI Gene record:
Cadps (27062)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518030.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119988 CGCCTATCTGAGTATGCCAAA pLKO.1 3161 CDS 100% 4.050 5.670 N Cadps n/a
2 TRCN0000119990 CCTGTAACTTTGACCACGCTT pLKO.1 2625 CDS 100% 2.640 3.696 N Cadps n/a
3 TRCN0000159415 GCATGGATGAATTTATCTCTT pLKO.1 2598 CDS 100% 4.950 3.465 N CADPS n/a
4 TRCN0000119989 GCCAAGAGCATCAATACCATT pLKO.1 4155 CDS 100% 4.950 3.465 N Cadps n/a
5 TRCN0000163058 CCCAATGTGAACCTACCCAAT pLKO.1 3731 CDS 100% 4.050 2.835 N CADPS n/a
6 TRCN0000119991 GCAGATCAAATAGCCAGGGAA pLKO.1 1547 CDS 100% 2.640 1.848 N Cadps n/a
7 TRCN0000119987 CCATTCTTAAACACTGTTCAT pLKO.1 4927 3UTR 100% 4.950 2.970 N Cadps n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518030.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11286 pDONR223 100% 50.6% 54.9% None (many diffs) n/a
2 ccsbBroad304_11286 pLX_304 0% 50.6% 54.9% V5 (many diffs) n/a
3 TRCN0000474770 CTTAATCAGTAGCTTACGTGGCTC pLX_317 10.7% 50.6% 54.9% V5 (many diffs) n/a
4 ccsbBroadEn_11285 pDONR223 100% 13.7% 14.7% None (many diffs) n/a
5 ccsbBroad304_11285 pLX_304 0% 13.7% 14.7% V5 (many diffs) n/a
6 TRCN0000472605 AGTAATGACTTTTAGGTGGCCGAA pLX_317 76.9% 13.7% 14.7% V5 (many diffs) n/a
Download CSV