Construct: ORF TRCN0000474770
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013583.1_s317c1
- Derived from:
- ccsbBroadEn_11286
- DNA Barcode:
- CTTAATCAGTAGCTTACGTGGCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CADPS (8618)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474770
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534198.3 | 59.8% | 59.7% | 1_1563del;3581A>G |
2 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007386.2 | 59.6% | 59.4% | 1_1563del;1967_1978del;3593A>G |
3 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007385.2 | 59.4% | 59.3% | (many diffs) |
4 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534200.3 | 59.3% | 59.2% | 1_1563del;2579_2580insAGAGAATCAAAAGGATGC;3563A>G |
5 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007384.2 | 59.3% | 59.1% | (many diffs) |
6 | human | 8618 | CADPS | calcium dependent secretion... | XM_006713378.3 | 59.1% | 59% | (many diffs) |
7 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534199.2 | 59.1% | 59% | (many diffs) |
8 | human | 8618 | CADPS | calcium dependent secretion... | NM_183394.3 | 58.8% | 58.4% | (many diffs) |
9 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007383.2 | 58.6% | 58.1% | (many diffs) |
10 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007380.2 | 58.3% | 57.8% | (many diffs) |
11 | human | 8618 | CADPS | calcium dependent secretion... | NM_183393.3 | 58% | 57.9% | (many diffs) |
12 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007377.2 | 57.6% | 57.5% | 1_1563del;3005_3151del;3728A>G |
13 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007375.1 | 57.4% | 57.3% | (many diffs) |
14 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007374.2 | 57.4% | 57.2% | (many diffs) |
15 | human | 8618 | CADPS | calcium dependent secretion... | NM_003716.4 | 57.3% | 57.2% | (many diffs) |
16 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007373.2 | 57.3% | 57.1% | (many diffs) |
17 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007371.2 | 57.2% | 57.1% | (many diffs) |
18 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007372.1 | 57.2% | 57.1% | (many diffs) |
19 | human | 8618 | CADPS | calcium dependent secretion... | XM_024453802.1 | 57.2% | 57% | (many diffs) |
20 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007370.2 | 57.1% | 57% | (many diffs) |
21 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534194.2 | 57.1% | 56.9% | (many diffs) |
22 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534193.2 | 57.1% | 56.9% | (many diffs) |
23 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534197.2 | 57% | 56.9% | (many diffs) |
24 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007379.2 | 57% | 56.8% | (many diffs) |
25 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007378.1 | 56.9% | 56.8% | (many diffs) |
26 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534192.2 | 56.9% | 56.8% | (many diffs) |
27 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007369.2 | 56.9% | 56.7% | (many diffs) |
28 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534203.2 | 56.8% | 56.6% | (many diffs) |
29 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007376.2 | 56.8% | 56.7% | (many diffs) |
30 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534191.3 | 56.7% | 56.2% | (many diffs) |
31 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534196.2 | 56.6% | 56.4% | (many diffs) |
32 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534195.2 | 56.6% | 56.5% | (many diffs) |
33 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007368.1 | 56.5% | 56% | (many diffs) |
34 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007366.2 | 56.3% | 55.9% | (many diffs) |
35 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007364.2 | 56.3% | 56.1% | (many diffs) |
36 | human | 8618 | CADPS | calcium dependent secretion... | XM_024453801.1 | 56.2% | 56% | (many diffs) |
37 | human | 8618 | CADPS | calcium dependent secretion... | XM_024453800.1 | 56.2% | 56% | (many diffs) |
38 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534189.2 | 56.1% | 55.7% | (many diffs) |
39 | human | 8618 | CADPS | calcium dependent secretion... | XM_024453799.1 | 56.1% | 55.9% | (many diffs) |
40 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007363.2 | 55.2% | 55% | (many diffs) |
41 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007362.2 | 55.1% | 54.9% | (many diffs) |
42 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534182.2 | 55% | 54.9% | (many diffs) |
43 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007361.2 | 55% | 54.8% | (many diffs) |
44 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534180.2 | 54.8% | 54.6% | (many diffs) |
45 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534183.2 | 54.6% | 54.4% | (many diffs) |
46 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007360.2 | 54.3% | 54.1% | (many diffs) |
47 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007359.2 | 54.2% | 54% | (many diffs) |
48 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534178.2 | 54.2% | 53.7% | (many diffs) |
49 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534177.2 | 54.2% | 53.9% | (many diffs) |
50 | human | 8618 | CADPS | calcium dependent secretion... | XM_017007358.2 | 54.1% | 53.8% | (many diffs) |
51 | human | 8618 | CADPS | calcium dependent secretion... | XM_011534202.3 | 25% | 24.9% | (many diffs) |
52 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_017316038.1 | 54.7% | 59.6% | (many diffs) |
53 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518044.3 | 54.3% | 59.2% | (many diffs) |
54 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518043.3 | 54.1% | 58.9% | (many diffs) |
55 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518041.3 | 53.8% | 58.3% | (many diffs) |
56 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_017316036.1 | 53.8% | 58.5% | (many diffs) |
57 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_017316037.1 | 53.7% | 58.1% | (many diffs) |
58 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_017316035.1 | 53.6% | 58.3% | (many diffs) |
59 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518040.3 | 53.5% | 58.1% | (many diffs) |
60 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_017316034.1 | 53.5% | 58.2% | (many diffs) |
61 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518039.3 | 53.2% | 57.8% | (many diffs) |
62 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_017316032.1 | 52.6% | 57.1% | (many diffs) |
63 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518035.3 | 52.5% | 57% | (many diffs) |
64 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518034.3 | 52.5% | 57.1% | (many diffs) |
65 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_017316031.1 | 52.3% | 57% | (many diffs) |
66 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | NM_001042617.1 | 52.3% | 56.9% | (many diffs) |
67 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518032.3 | 52.2% | 56.7% | (many diffs) |
68 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518048.3 | 52.1% | 56.8% | (many diffs) |
69 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518036.3 | 52% | 56.6% | (many diffs) |
70 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_017316033.1 | 52% | 56.6% | (many diffs) |
71 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | NM_012061.3 | 51.9% | 56.2% | (many diffs) |
72 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_017316030.1 | 51.8% | 56.2% | (many diffs) |
73 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518033.3 | 51.7% | 56.3% | (many diffs) |
74 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518031.3 | 51.7% | 55.9% | (many diffs) |
75 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518029.3 | 51.7% | 56.1% | (many diffs) |
76 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518028.3 | 51.6% | 56% | (many diffs) |
77 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_017316029.1 | 51.5% | 55.6% | (many diffs) |
78 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518026.3 | 51.5% | 55.9% | (many diffs) |
79 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518025.3 | 51.4% | 55.8% | (many diffs) |
80 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518027.3 | 51.4% | 55.5% | (many diffs) |
81 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518024.3 | 51.3% | 55.7% | (many diffs) |
82 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518030.3 | 50.6% | 54.9% | (many diffs) |
83 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518042.3 | 46.7% | 48.6% | (many diffs) |
84 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XR_001781126.1 | 35.9% | (many diffs) | |
85 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518045.3 | 25.1% | 26% | (many diffs) |
86 | mouse | 27062 | Cadps | Ca2+-dependent secretion ac... | XM_006518047.3 | 20% | 19.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2397
- ORF length:
- 2328
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaagcattct gggtatttat gggccatcgg taagaatgtc tggaagagat 121 ggaagaaaag gttttttgta ttggtgcagg tcagtcagta cacgtttgcc atgtgcagtt 181 atcgggagaa gaaagcggag cctcaggaac ttctacaatt ggatggctac actgtggatt 241 acaccgaccc ccagccaggt ttggagggtg gccgagcctt cttcaatgct gtcaaggagg 301 gagacaccgt gatatttgcc agtgacgatg aacaagaccg catcctgtgg gtccaggcca 361 tgtatcgggc cacggggcag tcacacaagc ctgtgccccc gacccaagtc cagaaactca 421 acgccaaggg aggaaatgta cctcagctgg atgcccctat ctctcaattt tacgcagata 481 gagctcaaaa acatggcatg gatgaattta tctcttccaa cccctgtaac tttgaccacg 541 cttccctctt tgagatggta caacgcctta ctttggatca cagacttaat gattcctatt 601 cttgcctggg ctggttcagt cctggccagg tgtttgtact agacgagtat tgcgcccgaa 661 atggagtccg ggggtgtcac cgacatctct gctacctcag agacttgctt gaacgggcag 721 aaaatggcgc catgatcgac cccacccttc ttcactacag ctttgccttc tgtgcatccc 781 atgtccatgg gaacaggcct gatggaattg gaactgtgac tgttgaagaa aaggaacgtt 841 ttgaagaaat caaagagagg ctccgagttc tgctagaaaa tcagattaca cattttaggt 901 attgctttcc atttggtcga cctgaaggtg ctttgaaagc tactctctca ctcttggaaa 961 gggttttgat gaaagatatt gttaccccag tgccacaaga ggaggtaaaa acagttatcc 1021 gtaaatgtct ggaacaggct gcgttagtca actattctcg gctctcagag tatgccaaaa 1081 tcgaagagaa tcaaaaggat gcagaaaatg taggccggtt aatcactcct gccaaaaagc 1141 ttgaagatac aatacgtctt gctgaactag tcattgaagt tcttcagcaa aatgaggagc 1201 accacgcaga ggcctttgcg tggtggtcag atttaatggt ggagcatgcg gagacgttcc 1261 tgtcactctt tgcagtagac atggatgcag ccttagaggt gcaacctcca gacacatggg 1321 acagttttcc actatttcag ctgctgaatg attttctccg tactgactat aatttgtgca 1381 atggaaaatt tcacaaacac ctgcaagacc tgtttgcccc acttgttgtt agatatgtgg 1441 atctgatgga gtcctcaatt gcacaatcca ttcacagggg ctttgagcgg gagtcatggg 1501 aaccagtcaa taatgggtca ggcacctcag aagatctgtt ttggaaactt gacgcccttc 1561 agaccttcat tcgggacctg cactggcctg aagaagagtt tggaaagcac ctggaacaac 1621 ggctgaagtt gatggcaagt gacatgatcg aatcttgtgt caaaagaacc aggattgcat 1681 ttgaagttaa gctgcaaaaa accagtcgat caacagattt tcgagtccca cagtcaatat 1741 gcaccatgtt taatgttatg gttgatgcca aagctcaatc aacaaaactt tgcagcatgg 1801 aaatgggcca agagcatcaa taccattcaa aaatagacga actaattgaa gaaactgtta 1861 aagaaatgat aacactcttg gttgcaaagt tcgttactat cttggaagga gtgctggcaa 1921 aattatccag atatgacgaa gggactttgt tttcttcttt tctgtcattt accgtgaagg 1981 cagcttccaa atatgtggat gtacctaaac ccgggatgga cgtggccgac gcctacgtga 2041 ctttcgtccg ccattctcag gatgtcctgc gtgataaggt caatggggag atgtacatag 2101 aaaggttatt tgatcaatgg tacaacagct ccatgaacgt gatctgcacc tggttGACGG 2161 ACCGGATGGA CTTACAGCTT CATATTTATC AGTTGAAAAC ACTAATTAGG ATGGTAAAGA 2221 AAACCTACAG AGATTTCCGA TTGCAAGGGG TCCTGGACTC CACCTTAAAC AGCAAGACCT 2281 ATGAAACGAT CCGGAACCGT CTCACTGTGG AGGAAGCCAC AGCATCAGTG AGTGAAGGTG 2341 GGGGACTGCA GGGCATCAGC ATGAAGGACA GCGATGAGGA AGACGAAGAA GACGATTTGC 2401 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 2461 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 2521 ATATATCTTG TGGAAAGGAC GACTTAATCA GTAGCTTACG TGGCTCACGC GTTAAGTCga 2581 caatcaacct ctggattaca aaatttgtga aagatt