Transcript: Mouse XM_006518498.2

PREDICTED: Mus musculus calcium/calmodulin-dependent protein kinase II gamma (Camk2g), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Camk2g (12325)
Length:
3733
CDS:
160..1743

Additional Resources:

NCBI RefSeq record:
XM_006518498.2
NBCI Gene record:
Camk2g (12325)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518498.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024183 CTACGCAGGAATATGCTGCAA pLKO.1 266 CDS 100% 2.640 3.696 N Camk2g n/a
2 TRCN0000361017 GGTAGAGTGCTTACGCAAATT pLKO_005 1020 CDS 100% 13.200 10.560 N Camk2g n/a
3 TRCN0000361079 ACTTGCTGCTGGCGAGTAAAT pLKO_005 581 CDS 100% 13.200 9.240 N Camk2g n/a
4 TRCN0000361080 ACGCAGCTTGCATCGCCTATA pLKO_005 1580 CDS 100% 10.800 7.560 N Camk2g n/a
5 TRCN0000382069 AGGATCAGCACAAGCTGTATC pLKO_005 809 CDS 100% 10.800 7.560 N CAMK2G n/a
6 TRCN0000380867 CGACTTCTGAAACATCCAAAC pLKO_005 355 CDS 100% 6.000 4.200 N CAMK2G n/a
7 TRCN0000000477 ACCTCGTGTTTGACCTTGTTA pLKO.1 419 CDS 100% 5.625 3.938 N CAMK2G n/a
8 TRCN0000024180 CCTGAGGTCTTGAGGAAAGAT pLKO.1 706 CDS 100% 5.625 3.938 N Camk2g n/a
9 TRCN0000024182 GAGGATCAGCACAAGCTGTAT pLKO.1 808 CDS 100% 4.950 3.465 N Camk2g n/a
10 TRCN0000381780 GATGGCAAGTGGCTCAATGTC pLKO_005 1681 CDS 100% 4.950 3.465 N CAMK2G n/a
11 TRCN0000380898 TGAGAATCTCCTGTCCAAGAA pLKO_005 1503 CDS 100% 4.950 3.465 N CAMK2G n/a
12 TRCN0000226388 TTGAGGCCTACACGAAGATTT pLKO_005 1403 CDS 100% 13.200 7.920 N CAMK2G n/a
13 TRCN0000361100 TTGAGGCCTACACGAAGATTT pLKO_005 1403 CDS 100% 13.200 7.920 N Camk2g n/a
14 TRCN0000380821 GGTTTCACTACCTCGTGTTTG pLKO_005 410 CDS 100% 10.800 6.480 N CAMK2G n/a
15 TRCN0000024179 GCCCGAGATCATCAGAAACTA pLKO.1 313 CDS 100% 5.625 3.375 N Camk2g n/a
16 TRCN0000381357 TGCTTGTCTCCAGGAACTTCT pLKO_005 1082 CDS 100% 4.950 3.465 N CAMK2G n/a
17 TRCN0000000478 AGAACAGCAAGCCTATCCATA pLKO.1 1520 CDS 100% 4.950 2.970 N CAMK2G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518498.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14566 pDONR223 100% 86.1% 47.4% None (many diffs) n/a
2 ccsbBroad304_14566 pLX_304 0% 86.1% 47.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000480621 AAGACTGTGGCACCAACTCCCGCC pLX_317 29.4% 86.1% 47.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_14563 pDONR223 93.6% 73.2% 83.5% None (many diffs) n/a
5 ccsbBroad304_14563 pLX_304 0% 73.2% 83.5% V5 (many diffs) n/a
6 TRCN0000468031 AGCATTTCATGGTGGACCTTTAGT pLX_317 28.9% 70.2% 80.3% V5 (not translated due to frame shift) (many diffs) n/a
7 ccsbBroadEn_14564 pDONR223 0% 73.2% 83.5% None (many diffs) n/a
8 ccsbBroad304_14564 pLX_304 0% 73.2% 83.5% V5 (many diffs) n/a
9 TRCN0000480225 GACAGTGGGGGTGATCTCGGAGCG pLX_317 22.3% 73.2% 83.5% V5 (many diffs) n/a
Download CSV