Transcript: Mouse XM_006518881.3

PREDICTED: Mus musculus X-linked Kx blood group related 6 (Xkr6), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Xkr6 (219149)
Length:
3675
CDS:
1972..3120

Additional Resources:

NCBI RefSeq record:
XM_006518881.3
NBCI Gene record:
Xkr6 (219149)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518881.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265290 GAGGCTGCGGAGGACTATTAA pLKO_005 3006 CDS 100% 15.000 21.000 N Xkr6 n/a
2 TRCN0000258107 ACCGAATGTTCGCATACTATA pLKO_005 2513 CDS 100% 13.200 18.480 N Xkr6 n/a
3 TRCN0000140512 GCCTTGACGTTCCTTTGGTAT pLKO.1 2557 CDS 100% 4.950 6.930 N XKR6 n/a
4 TRCN0000180895 GCTCTTATACTATGGCGTGTT pLKO.1 2667 CDS 100% 4.050 5.670 N Xkr6 n/a
5 TRCN0000250945 TGATACTTGCCTGCCGGTATT pLKO_005 2862 CDS 100% 10.800 8.640 N Xkr6 n/a
6 TRCN0000265298 CACCATCTCATCCCGAGTTAT pLKO_005 2292 CDS 100% 13.200 9.240 N Xkr6 n/a
7 TRCN0000258093 CACCTTGACCCAGATTGAGAA pLKO_005 3123 3UTR 100% 4.950 3.465 N Xkr6 n/a
8 TRCN0000178899 CTGCATAATGATCCAGAAGAA pLKO.1 2115 CDS 100% 4.950 3.465 N Xkr6 n/a
9 TRCN0000139423 CTTCAACATGGTGGTAGGGAT pLKO.1 2445 CDS 100% 2.640 1.848 N XKR6 n/a
10 TRCN0000180493 GCCTGCAAGAAATATAACCCT pLKO.1 3175 3UTR 100% 0.750 0.525 N Xkr6 n/a
11 TRCN0000139947 GCTCTTATACTATGGCGTGCT pLKO.1 2667 CDS 100% 2.160 3.024 N XKR6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518881.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13561 pDONR223 100% 87.7% 90% None (many diffs) n/a
2 ccsbBroad304_13561 pLX_304 0% 87.7% 90% V5 (many diffs) n/a
3 TRCN0000480600 ACCCCCAGATACATGTGCAGCTTT pLX_317 39.6% 87.7% 90% V5 (many diffs) n/a
Download CSV