Transcript: Mouse XM_006519484.3

PREDICTED: Mus musculus mitochondrial calcium uptake 2 (Micu2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Micu2 (68514)
Length:
2341
CDS:
39..1334

Additional Resources:

NCBI RefSeq record:
XM_006519484.3
NBCI Gene record:
Micu2 (68514)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006519484.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104684 CTGCAGAAGATCATAAGTAAA pLKO.1 627 CDS 100% 13.200 9.240 N Micu2 n/a
2 TRCN0000104682 CGCCATGCAAATGTTTAGTTT pLKO.1 1028 CDS 100% 5.625 3.938 N Micu2 n/a
3 TRCN0000055850 GCTGCAGAAGATCATAAGTAA pLKO.1 626 CDS 100% 5.625 3.938 N MICU2 n/a
4 TRCN0000286722 GCTGCAGAAGATCATAAGTAA pLKO_005 626 CDS 100% 5.625 3.938 N MICU2 n/a
5 TRCN0000104680 CCTGCCTTGAAATAGCACATA pLKO.1 1839 3UTR 100% 4.950 3.465 N Micu2 n/a
6 TRCN0000104683 CGAGGATGTACTGTCAGGAAT pLKO.1 425 CDS 100% 4.950 3.465 N Micu2 n/a
7 TRCN0000104681 GCCATGCAAATGTTTAGTTTA pLKO.1 1029 CDS 100% 13.200 7.920 N Micu2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006519484.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16131 pDONR223 0% 83.3% 84.9% None (many diffs) n/a
2 ccsbBroad304_16131 pLX_304 0% 83.3% 84.9% V5 (many diffs) n/a
3 TRCN0000480119 GGTCCACTGTTAAACGCCGCTGGG pLX_317 31.3% 83.3% 84.7% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_09868 pDONR223 100% 83% 84.4% None (many diffs) n/a
5 ccsbBroad304_09868 pLX_304 0% 83% 84.4% V5 (many diffs) n/a
6 TRCN0000480665 CACCATTCAATAATCAGCAACCTC pLX_317 34.1% 83% 84.4% V5 (many diffs) n/a
Download CSV