Transcript: Mouse XM_006520897.2

PREDICTED: Mus musculus zinc finger protein, multitype 2 (Zfpm2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfpm2 (22762)
Length:
4969
CDS:
661..3957

Additional Resources:

NCBI RefSeq record:
XM_006520897.2
NBCI Gene record:
Zfpm2 (22762)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520897.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096512 GCCTACAGCTATTGTCAATAA pLKO.1 1221 CDS 100% 13.200 18.480 N Zfpm2 n/a
2 TRCN0000312069 GCCTACAGCTATTGTCAATAA pLKO_005 1221 CDS 100% 13.200 18.480 N Zfpm2 n/a
3 TRCN0000096511 GCGCAGAAGAACAGTTGTCTA pLKO.1 3788 CDS 100% 4.950 6.930 N Zfpm2 n/a
4 TRCN0000313108 GGATAAAGCCAAGCGATTATA pLKO_005 3458 CDS 100% 15.000 12.000 N Zfpm2 n/a
5 TRCN0000096510 GCGAAGAAAGATGTACGAAAT pLKO.1 2712 CDS 100% 10.800 8.640 N Zfpm2 n/a
6 TRCN0000312070 GCGAAGAAAGATGTACGAAAT pLKO_005 2712 CDS 100% 10.800 8.640 N Zfpm2 n/a
7 TRCN0000096509 GCCGTATATTTCTGTCCATTT pLKO.1 4548 3UTR 100% 10.800 7.560 N Zfpm2 n/a
8 TRCN0000349415 GCCGTATATTTCTGTCCATTT pLKO_005 4548 3UTR 100% 10.800 7.560 N Zfpm2 n/a
9 TRCN0000096513 CCTTCAAACATCCTGCATCAA pLKO.1 2361 CDS 100% 4.950 3.465 N Zfpm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520897.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000468757 CAAGGTTGCAACAGACTCTACTTT pLX_317 12% 85.1% 90% V5 (many diffs) n/a
Download CSV