Transcript: Mouse XM_006522072.3

PREDICTED: Mus musculus p21 protein (Cdc42/Rac)-activated kinase 2 (Pak2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pak2 (224105)
Length:
5701
CDS:
243..1817

Additional Resources:

NCBI RefSeq record:
XM_006522072.3
NBCI Gene record:
Pak2 (224105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522072.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432870 TTCGGATGAGCAGTACCATTT pLKO_005 289 CDS 100% 10.800 15.120 N Pak2 n/a
2 TRCN0000417285 ATGATTGATGTAGCTCTTTAC pLKO_005 2286 3UTR 100% 10.800 8.640 N Pak2 n/a
3 TRCN0000426554 GTTGCTATCAAGCAGATTAAT pLKO_005 1065 CDS 100% 15.000 10.500 N Pak2 n/a
4 TRCN0000413412 GCCGTGTGCAGAGAGTGTTTA pLKO_005 1281 CDS 100% 13.200 9.240 N Pak2 n/a
5 TRCN0000415469 AGTAAGAGAGCTATGACTTTG pLKO_005 1973 3UTR 100% 10.800 7.560 N Pak2 n/a
6 TRCN0000025210 CCCAATATTTCGGGATTTCTT pLKO.1 1652 CDS 100% 5.625 3.938 N Pak2 n/a
7 TRCN0000199395 CCATCCATGTTGGCTTTGATG pLKO.1 490 CDS 100% 4.950 3.465 N PAK2 n/a
8 TRCN0000025209 CGATGAAGAGATTATGGAGAA pLKO.1 926 CDS 100% 4.050 2.835 N Pak2 n/a
9 TRCN0000025211 CCAATCACAGTTTGAAACCTT pLKO.1 340 CDS 100% 3.000 2.100 N Pak2 n/a
10 TRCN0000025213 GCAGACCTCCAACATTACCAA pLKO.1 560 CDS 100% 3.000 2.100 N Pak2 n/a
11 TRCN0000025212 GAGTTAAAGAATCCCAACATA pLKO.1 1140 CDS 100% 5.625 3.375 N Pak2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522072.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489535 GCAGTAAATGTCCGGGTTTTCCCC pLX_317 25.3% 89.6% 97.1% V5 (many diffs) n/a
2 ccsbBroadEn_14727 pDONR223 0% 89.5% 96.9% None (many diffs) n/a
3 ccsbBroad304_14727 pLX_304 0% 89.5% 96.9% V5 (many diffs) n/a
Download CSV