Transcript: Mouse XM_006522137.1

PREDICTED: Mus musculus polymerase (RNA) II (DNA directed) polypeptide H (Polr2h), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Polr2h (245841)
Length:
1118
CDS:
529..873

Additional Resources:

NCBI RefSeq record:
XM_006522137.1
NBCI Gene record:
Polr2h (245841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006522137.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111330 CTGTCGGTGTTAGCCTGTAAA pLKO.1 943 3UTR 100% 13.200 18.480 N Polr2h n/a
2 TRCN0000354229 CTGTCGGTGTTAGCCTGTAAA pLKO_005 943 3UTR 100% 13.200 18.480 N Polr2h n/a
3 TRCN0000111331 GCCAACAACCTGCATGGATTT pLKO.1 805 CDS 100% 10.800 7.560 N Polr2h n/a
4 TRCN0000332520 GCCAACAACCTGCATGGATTT pLKO_005 805 CDS 100% 10.800 7.560 N Polr2h n/a
5 TRCN0000111334 CCTCATCTTAGATGTAAACAT pLKO.1 534 CDS 100% 5.625 3.938 N Polr2h n/a
6 TRCN0000332448 CCTCATCTTAGATGTAAACAT pLKO_005 534 CDS 100% 5.625 3.938 N Polr2h n/a
7 TRCN0000111333 TGAGAGTGAATCTTTCAAGAT pLKO.1 510 5UTR 100% 4.950 3.465 N Polr2h n/a
8 TRCN0000332523 TGAGAGTGAATCTTTCAAGAT pLKO_005 510 5UTR 100% 4.950 3.465 N Polr2h n/a
9 TRCN0000053069 CTGACCAGTTTGAGTATGTAA pLKO.1 674 CDS 100% 5.625 3.938 N POLR2H n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006522137.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06750 pDONR223 98.7% 70.4% 76% None (many diffs) n/a
2 ccsbBroad304_06750 pLX_304 0% 70.4% 76% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000475146 ACAGAAAAAGGGAAGGGTGTATCC pLX_317 57.4% 70.4% 76% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV