Transcript: Mouse XM_006523198.3

PREDICTED: Mus musculus ribosomal protein S6 kinase, polypeptide 2 (Rps6ka2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rps6ka2 (20112)
Length:
5256
CDS:
129..2282

Additional Resources:

NCBI RefSeq record:
XM_006523198.3
NBCI Gene record:
Rps6ka2 (20112)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006523198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022965 ACTCCATATCTGATGCAGCAA pLKO.1 1996 CDS 100% 2.640 3.696 N Rps6ka2 n/a
2 TRCN0000022967 TCGTGAACAGAGAGTACCTAT pLKO.1 2095 CDS 100% 4.950 3.960 N Rps6ka2 n/a
3 TRCN0000022709 CCCTGCTATACTGCAAACTTT pLKO.1 1791 CDS 100% 5.625 3.938 N Rps6ka2 n/a
4 TRCN0000022710 GAAACCAAGTAACATTCTGTA pLKO.1 1679 CDS 100% 4.950 3.465 N Rps6ka2 n/a
5 TRCN0000022713 GTCGTATGGAAAGGTGTTCTT pLKO.1 284 CDS 100% 4.950 3.465 N Rps6ka2 n/a
6 TRCN0000022968 TGAGGAGATTCTGGCTAGGAT pLKO.1 1937 CDS 100% 3.000 2.100 N Rps6ka2 n/a
7 TRCN0000022711 GCTTTCCAAAGAGGTGATGTT pLKO.1 527 CDS 100% 4.950 2.970 N Rps6ka2 n/a
8 TRCN0000022712 GCATGAAGAGACTCACGTCTA pLKO.1 2251 CDS 100% 4.050 2.025 Y Rps6ka2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006523198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487867 TATTGTCCAGCGGTTTTTGCCCCT pLX_317 8.8% 84.4% 92% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14831 pDONR223 72.3% 84.1% 30.3% None (many diffs) n/a
3 ccsbBroad304_14831 pLX_304 0% 84.1% 30.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV