Transcript: Mouse XM_006524194.2

PREDICTED: Mus musculus mitogen-activated protein kinase kinase kinase kinase 3 (Map4k3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Map4k3 (225028)
Length:
4314
CDS:
317..2980

Additional Resources:

NCBI RefSeq record:
XM_006524194.2
NBCI Gene record:
Map4k3 (225028)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339149 GTCCCGAAACCAATTAGTAAT pLKO_005 1877 CDS 100% 13.200 18.480 N Map4k3 n/a
2 TRCN0000025293 CGTCCCGAAACCAATTAGTAA pLKO.1 1876 CDS 100% 5.625 7.875 N Map4k3 n/a
3 TRCN0000025289 CCGAGATATAAAGGGCGCTAA pLKO.1 718 CDS 100% 4.050 5.670 N Map4k3 n/a
4 TRCN0000025292 CGGAATGTCAACACTGGAGAA pLKO.1 416 CDS 100% 4.050 5.670 N Map4k3 n/a
5 TRCN0000339148 CGGAATGTCAACACTGGAGAA pLKO_005 416 CDS 100% 4.050 5.670 N Map4k3 n/a
6 TRCN0000380444 GAACCACACAAGTGCTTAATT pLKO_005 3161 3UTR 100% 15.000 10.500 N MAP4K3 n/a
7 TRCN0000025290 CCCAACAGCAAATAGCAATTT pLKO.1 2926 CDS 100% 13.200 9.240 N Map4k3 n/a
8 TRCN0000335963 TACTACACTGCAAGATCTAAT pLKO_005 1412 CDS 100% 13.200 9.240 N MAP4K3 n/a
9 TRCN0000339119 TACTACACTGCAAGATCTAAT pLKO_005 1412 CDS 100% 13.200 9.240 N Map4k3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524194.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489242 TTAAAATAGGCACATTTAAGAAGG pLX_317 14.2% 86.2% 93% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491548 AAGAATCCAGGAGATGAAACCATC pLX_317 14.3% 86.1% 92.9% V5 (many diffs) n/a
3 ccsbBroadEn_14897 pDONR223 0% 83.9% 90.8% None (many diffs) n/a
4 ccsbBroad304_14897 pLX_304 0% 83.9% 90.8% V5 (many diffs) n/a
5 TRCN0000472930 GTTACTAACTGCTTGTCGTGATCA pLX_317 14.7% 83.9% 90.8% V5 (many diffs) n/a
6 TRCN0000466325 CACGGACAGTCGCTCTGTAAGGGC pLX_317 15.9% 83.6% 90.3% V5 (many diffs) n/a
Download CSV