Transcript: Mouse XM_006526092.3

PREDICTED: Mus musculus low density lipoprotein receptor class A domain containing 4 (Ldlrad4), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ldlrad4 (52662)
Length:
3438
CDS:
191..880

Additional Resources:

NCBI RefSeq record:
XM_006526092.3
NBCI Gene record:
Ldlrad4 (52662)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526092.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000258123 CGTGTCGTGTGAAGTTCTATA pLKO_005 1531 3UTR 100% 13.200 18.480 N Ldlrad4 n/a
2 TRCN0000251031 CCTATGTGCAGCACGAGATTG pLKO_005 438 CDS 100% 10.800 15.120 N Ldlrad4 n/a
3 TRCN0000438041 CCTATGTGCAGCACGAGATTG pLKO_005 438 CDS 100% 10.800 15.120 N LDLRAD4 n/a
4 TRCN0000194630 GCCGTGTACTACTGAGGTATT pLKO.1 1710 3UTR 100% 10.800 15.120 N Ldlrad4 n/a
5 TRCN0000251030 TCGCGCAGATCCTTATCATTG pLKO_005 153 5UTR 100% 10.800 15.120 N Ldlrad4 n/a
6 TRCN0000251032 ACAGTGACTTGATAGACATTT pLKO_005 603 CDS 100% 13.200 9.240 N Ldlrad4 n/a
7 TRCN0000194629 GAACAACTCAGAGGGCACAAT pLKO.1 814 CDS 100% 4.950 3.465 N Ldlrad4 n/a
8 TRCN0000175935 GACAGTGACTTGATAGACATT pLKO.1 602 CDS 100% 4.950 3.465 N Ldlrad4 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3374 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000149434 GCACAATAGTACCCATCAAAG pLKO.1 828 CDS 100% 10.800 7.560 N LDLRAD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526092.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10703 pDONR223 100% 86.5% 86% None (many diffs) n/a
2 ccsbBroad304_10703 pLX_304 0% 86.5% 86% V5 (many diffs) n/a
3 TRCN0000466878 AAAATCGACTATGATTGACAGGTG pLX_317 58.9% 86.5% 86% V5 (many diffs) n/a
4 ccsbBroadEn_00195 pDONR223 100% 60.9% 61.1% None (many diffs) n/a
5 ccsbBroad304_00195 pLX_304 0% 60.9% 61.1% V5 (many diffs) n/a
6 TRCN0000475780 TGCGGTATATTATACATCTTCCCA pLX_317 40.4% 60.9% 61.1% V5 (many diffs) n/a
Download CSV