Construct: ORF TRCN0000475780
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012338.1_s317c1
- Derived from:
- ccsbBroadEn_00195
- DNA Barcode:
- TGCGGTATATTATACATCTTCCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LDLRAD4 (753)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475780
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 753 | LDLRAD4 | low density lipoprotein rec... | NM_181482.5 | 100% | 100% | |
2 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_024451259.1 | 100% | 100% | |
3 | human | 753 | LDLRAD4 | low density lipoprotein rec... | NM_181481.4 | 94.1% | 94.1% | 335_388del |
4 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_005258140.1 | 94.1% | 94.1% | 335_388del |
5 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_006722353.1 | 94.1% | 94.1% | 335_388del |
6 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_006722354.1 | 94.1% | 94.1% | 335_388del |
7 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_024451248.1 | 94.1% | 94.1% | 335_388del |
8 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_024451249.1 | 94.1% | 94.1% | 335_388del |
9 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_024451250.1 | 94.1% | 94.1% | 335_388del |
10 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_024451251.1 | 94.1% | 94.1% | 335_388del |
11 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_024451252.1 | 94.1% | 94.1% | 335_388del |
12 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_024451253.1 | 94.1% | 94.1% | 335_388del |
13 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_024451254.1 | 94.1% | 94.1% | 335_388del |
14 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_024451255.1 | 94.1% | 94.1% | 335_388del |
15 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_024451256.1 | 94.1% | 94.1% | 335_388del |
16 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_024451257.1 | 94.1% | 94.1% | 335_388del |
17 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_024451258.1 | 94.1% | 94.1% | 335_388del |
18 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_017025962.1 | 84.6% | 71.6% | (many diffs) |
19 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_024451260.1 | 83.6% | 83.3% | 40_41ins141 |
20 | human | 753 | LDLRAD4 | low density lipoprotein rec... | NM_001003675.3 | 82.2% | 80% | (many diffs) |
21 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_017025961.1 | 79.8% | 67.8% | (many diffs) |
22 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_011525737.1 | 78.7% | 78.4% | 40_41ins141;194_247del |
23 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_017025963.2 | 78.7% | 78.4% | 40_41ins141;194_247del |
24 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_017025964.1 | 78.7% | 78.4% | 40_41ins141;194_247del |
25 | human | 753 | LDLRAD4 | low density lipoprotein rec... | NM_001003674.3 | 77.4% | 75.3% | (many diffs) |
26 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_017025972.1 | 73.2% | 73.2% | 0_1ins231 |
27 | human | 753 | LDLRAD4 | low density lipoprotein rec... | NM_001276249.1 | 68.9% | 68.9% | 0_1ins231;104_157del |
28 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_011525738.1 | 68.9% | 68.9% | 0_1ins231;104_157del |
29 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_017025965.1 | 68.9% | 68.9% | 0_1ins231;104_157del |
30 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_017025966.1 | 68.9% | 68.9% | 0_1ins231;104_157del |
31 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_017025967.1 | 68.9% | 68.9% | 0_1ins231;104_157del |
32 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_017025968.1 | 68.9% | 68.9% | 0_1ins231;104_157del |
33 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_017025969.1 | 68.9% | 68.9% | 0_1ins231;104_157del |
34 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_017025970.1 | 68.9% | 68.9% | 0_1ins231;104_157del |
35 | human | 753 | LDLRAD4 | low density lipoprotein rec... | XM_017025971.1 | 68.9% | 68.9% | 0_1ins231;104_157del |
36 | human | 753 | LDLRAD4 | low density lipoprotein rec... | NM_001276251.1 | 67.5% | 63.1% | (many diffs) |
37 | mouse | 52662 | Ldlrad4 | low density lipoprotein rec... | NM_172631.3 | 84.4% | 85.9% | (many diffs) |
38 | mouse | 52662 | Ldlrad4 | low density lipoprotein rec... | XM_006526085.3 | 84.4% | 85.9% | (many diffs) |
39 | mouse | 52662 | Ldlrad4 | low density lipoprotein rec... | XM_006526086.3 | 84.4% | 85.9% | (many diffs) |
40 | mouse | 52662 | Ldlrad4 | low density lipoprotein rec... | XM_006526087.3 | 84.4% | 85.9% | (many diffs) |
41 | mouse | 52662 | Ldlrad4 | low density lipoprotein rec... | XM_006526088.3 | 84.4% | 85.9% | (many diffs) |
42 | mouse | 52662 | Ldlrad4 | low density lipoprotein rec... | XM_006526089.3 | 84.4% | 85.9% | (many diffs) |
43 | mouse | 52662 | Ldlrad4 | low density lipoprotein rec... | XM_006526092.3 | 60.9% | 61.1% | (many diffs) |
44 | mouse | 52662 | Ldlrad4 | low density lipoprotein rec... | XM_011246973.2 | 60.9% | 61.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 930
- ORF length:
- 864
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc ggaagctggt tttcaggcca caaatgcttt cacagagtgc aaattcacct 121 gcaccagtgg taaatgcttg tatcttggtt cgctggtctg taaccaacag aacgactgtg 181 gggacaacag tgacgaagag aactgtctcc tggtgaccga gcacccgcct ccgggcatct 241 tcaactcgga gctggagttc gcccaaatca tcatcatcgt cgtggtggtc acggtgatgg 301 tggtggtcat cgtctgcctg ctgaaccact acaaagtctc cacgcggtcc ttcatcaacc 361 gcccgaacca gagccggagg cgggaggacg ggctgccgca gatcatgcat gccccgcggt 421 ccagggacag gttcacagcg ccgtccttca tccagaggga tcgcttcagc cgcttccagc 481 ccacctaccc ctatgtgcag cacgagattg atcttcctcc caccatctcc ctgtccgacg 541 gtgaagagcc acctccttac caggggccct gcaccctgca gcTCCGGGAC CCTGAACAGC 601 AGATGGAACT CAACCGAGAG TCCGTGAGGG CCCCACCCAA CCGAACCATA TTTGACAGTG 661 ATTTAATAGA CATTGCTATG TATAGCGGGG GTCCATGCCC ACCCAGCAGC AACTCGGGCA 721 TCAGTGCAAG CACCTGCAGC AGTAACGGGA GGATGGAGGG GCCACCCCCC ACATACAGCG 781 AGGTGATGGG CCACCACCCA GGCGCCTCTT TCCTCCATCA CCAGCGCAGC AACGCACACA 841 GGGGCAGCAG ACTGCAGTTT CAGCAGAACA ATGCAGAGAG CACAATAGTA CCCATCAAAG 901 GCAAAGATAG GAAGCCTGGG AACCTGGTCT GCCCAACTTT CTTGTACAAA GTGGTTGATA 961 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1021 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATGCGG 1081 TATATTATAC ATCTTCCCAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1141 tgaaagatt