Transcript: Mouse XM_006526437.3

PREDICTED: Mus musculus katanin p60 subunit A-like 2 (Katnal2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Katnal2 (71206)
Length:
2857
CDS:
999..2618

Additional Resources:

NCBI RefSeq record:
XM_006526437.3
NBCI Gene record:
Katnal2 (71206)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526437.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434509 GGAATATGAGAGCTATTATTT pLKO_005 1217 CDS 100% 15.000 21.000 N Katnal2 n/a
2 TRCN0000090749 CGGGACATTTATCTCCATAAT pLKO.1 1725 CDS 100% 13.200 10.560 N Katnal2 n/a
3 TRCN0000425752 ACGTTGACCTGGAAACTATTT pLKO_005 1192 CDS 100% 13.200 9.240 N Katnal2 n/a
4 TRCN0000437626 AGCCGTTGTGTACCCAATAAG pLKO_005 1805 CDS 100% 13.200 9.240 N Katnal2 n/a
5 TRCN0000437140 CACCAGAAGTCACGACCTAAA pLKO_005 1371 CDS 100% 10.800 7.560 N Katnal2 n/a
6 TRCN0000090751 CTTCGGATGAAGACGGAGTTA pLKO.1 2121 CDS 100% 4.950 3.465 N Katnal2 n/a
7 TRCN0000090752 CCTTCGGATGAAGACGGAGTT pLKO.1 2120 CDS 100% 4.050 2.835 N Katnal2 n/a
8 TRCN0000090750 GCTGTTTGAACTTGCGCGATA pLKO.1 2012 CDS 100% 4.050 2.835 N Katnal2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526437.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09098 pDONR223 100% 72.8% 74.4% None (many diffs) n/a
2 ccsbBroad304_09098 pLX_304 0% 72.8% 74.4% V5 (many diffs) n/a
3 TRCN0000478313 AGCACCATTAGGCTCGGACTTCCG pLX_317 20.4% 72.8% 74.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV