Transcript: Mouse XM_006527309.3

PREDICTED: Mus musculus family with sequence similarity 45, member A (Fam45a), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam45a (67894)
Length:
2404
CDS:
110..1264

Additional Resources:

NCBI RefSeq record:
XM_006527309.3
NBCI Gene record:
Fam45a (67894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527309.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329147 GCCGCCTTCACTAGGATATTG pLKO_005 497 CDS 100% 13.200 18.480 N Fam45a n/a
2 TRCN0000329151 TAAAGAGATTGGTCAACTAAT pLKO_005 1018 CDS 100% 13.200 18.480 N Fam45a n/a
3 TRCN0000175315 CCAGCCCATAATGCTTTCATA pLKO.1 2048 3UTR 100% 5.625 7.875 N Fam45a n/a
4 TRCN0000329150 CAGACCTCTATGACGTGTTTG pLKO_005 927 CDS 100% 10.800 8.640 N Fam45a n/a
5 TRCN0000174340 CATTCTTACATGCACCTTCAT pLKO.1 830 CDS 100% 4.950 3.960 N Fam45a n/a
6 TRCN0000329221 TCCTAGTACCCATTGACATTA pLKO_005 1311 3UTR 100% 13.200 9.240 N Fam45a n/a
7 TRCN0000329222 TCTAGCAGCAGCTGAACAAAT pLKO_005 1231 CDS 100% 13.200 9.240 N Fam45a n/a
8 TRCN0000215338 CTCCATCAAAGACATTGTATC pLKO.1 661 CDS 100% 10.800 7.560 N Fam45a n/a
9 TRCN0000194105 GAAATCAGACAGCCAGGTTAT pLKO.1 1063 CDS 100% 10.800 7.560 N Fam45a n/a
10 TRCN0000174458 CAATTTGGAATGGAAACTGTT pLKO.1 683 CDS 100% 4.950 3.465 N Fam45a n/a
11 TRCN0000173241 CCAGACCTCTATGACGTGTTT pLKO.1 926 CDS 100% 4.950 3.465 N Fam45a n/a
12 TRCN0000141718 GCTGGCTCCATCAAAGACATT pLKO.1 656 CDS 100% 4.950 3.465 N DENND10P1 n/a
13 TRCN0000193388 CTGCATAAAGAGATTGGTCAA pLKO.1 1013 CDS 100% 4.050 2.835 N Fam45a n/a
14 TRCN0000193953 GTGTTTGTGAATCTGGCAGAT pLKO.1 941 CDS 100% 4.050 2.835 N Fam45a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527309.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05655 pDONR223 100% 82.4% 80.8% None (many diffs) n/a
2 ccsbBroad304_05655 pLX_304 0% 82.4% 80.8% V5 (many diffs) n/a
3 TRCN0000471589 AGATGCAGCGCCACAGGGAATCAA pLX_317 33.1% 82.4% 80.8% V5 (many diffs) n/a
4 ccsbBroadEn_08599 pDONR223 100% 82.1% 80.6% None (many diffs) n/a
5 ccsbBroad304_08599 pLX_304 0% 82.1% 80.6% V5 (many diffs) n/a
6 TRCN0000475565 CGACCGCATCACTAATATAACCAG pLX_317 27.7% 82.1% 80.6% V5 (many diffs) n/a
Download CSV