Transcript: Mouse XM_006527562.3

PREDICTED: Mus musculus chloride channel, voltage-sensitive 5 (Clcn5), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clcn5 (12728)
Length:
7458
CDS:
403..2889

Additional Resources:

NCBI RefSeq record:
XM_006527562.3
NBCI Gene record:
Clcn5 (12728)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527562.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069494 CCTATGATGATTTCAACACAA pLKO.1 686 CDS 100% 4.950 6.930 N Clcn5 n/a
2 TRCN0000352186 CCTATGATGATTTCAACACAA pLKO_005 686 CDS 100% 4.950 6.930 N Clcn5 n/a
3 TRCN0000069496 CGGATGACTGTTTCTCTTGTT pLKO.1 2194 CDS 100% 4.950 6.930 N Clcn5 n/a
4 TRCN0000352263 CGGATGACTGTTTCTCTTGTT pLKO_005 2194 CDS 100% 4.950 6.930 N Clcn5 n/a
5 TRCN0000069493 CCATTCATTGTACTAGGCATA pLKO.1 1609 CDS 100% 4.050 3.240 N Clcn5 n/a
6 TRCN0000352262 CCATTCATTGTACTAGGCATA pLKO_005 1609 CDS 100% 4.050 3.240 N Clcn5 n/a
7 TRCN0000043904 GCACCGAGAGATTACCAATAA pLKO.1 744 CDS 100% 13.200 9.240 N CLCN5 n/a
8 TRCN0000069495 CCTTGCTGTATCTCTTGTCAA pLKO.1 1104 CDS 100% 4.950 3.465 N Clcn5 n/a
9 TRCN0000352261 CCTTGCTGTATCTCTTGTCAA pLKO_005 1104 CDS 100% 4.950 3.465 N Clcn5 n/a
10 TRCN0000069497 GCTCACTGGATGACAGACTTA pLKO.1 883 CDS 100% 4.950 3.465 N Clcn5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527562.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00322 pDONR223 100% 82.5% 88.2% None (many diffs) n/a
2 ccsbBroad304_00322 pLX_304 0% 82.5% 88.2% V5 (many diffs) n/a
3 TRCN0000480726 CTTCCATCTTGATATGAGCGCTCT pLX_317 17.9% 82.5% 88.2% V5 (many diffs) n/a
Download CSV