Transcript: Mouse XM_006528023.3

PREDICTED: Mus musculus dyskeratosis congenita 1, dyskerin (Dkc1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dkc1 (245474)
Length:
2856
CDS:
236..1840

Additional Resources:

NCBI RefSeq record:
XM_006528023.3
NBCI Gene record:
Dkc1 (245474)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528023.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219063 ATATCAGGACCGGTTTCATTA pLKO_005 567 CDS 100% 13.200 18.480 N Dkc1 n/a
2 TRCN0000234223 CACCTACATTCGGACACTATG pLKO_005 979 CDS 100% 10.800 8.640 N Dkc1 n/a
3 TRCN0000234224 GTAACTATCTGCAGCTATTTA pLKO_005 2109 3UTR 100% 15.000 10.500 N Dkc1 n/a
4 TRCN0000219093 GAAGATGATGTTGCCGAAATA pLKO_005 380 CDS 100% 13.200 9.240 N Dkc1 n/a
5 TRCN0000234222 GTAGCCTGGATCCGACGAATA pLKO_005 626 CDS 100% 10.800 7.560 N Dkc1 n/a
6 TRCN0000039742 CGGCTGCACAATGCTATTGAA pLKO.1 782 CDS 100% 5.625 3.938 N DKC1 n/a
7 TRCN0000332893 CGGCTGCACAATGCTATTGAA pLKO_005 782 CDS 100% 5.625 3.938 N DKC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528023.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00446 pDONR223 100% 83.5% 85.7% None (many diffs) n/a
2 ccsbBroad304_00446 pLX_304 0% 83.5% 85.7% V5 (many diffs) n/a
3 TRCN0000474791 CTCTCTGCTTGCCACGACCCGTTG pLX_317 23.3% 83.5% 85.7% V5 (many diffs) n/a
4 ccsbBroadEn_15398 pDONR223 0% 83.4% 85.5% None (many diffs) n/a
5 ccsbBroad304_15398 pLX_304 0% 83.4% 85.5% V5 (many diffs) n/a
6 TRCN0000473317 TAAGATGAATGGCACCACTCGTTC pLX_317 31.5% 83.4% 85.5% V5 (many diffs) n/a
Download CSV