Transcript: Mouse XM_006528806.2

PREDICTED: Mus musculus adhesion G protein-coupled receptor G2 (Adgrg2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adgrg2 (237175)
Length:
5367
CDS:
508..3786

Additional Resources:

NCBI RefSeq record:
XM_006528806.2
NBCI Gene record:
Adgrg2 (237175)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528806.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414292 GTTCAGCTCTGTCGAATTAAA pLKO_005 3160 CDS 100% 15.000 21.000 N Adgrg2 n/a
2 TRCN0000423479 TATCACGGTTGTGGGATATTT pLKO_005 3093 CDS 100% 15.000 21.000 N Adgrg2 n/a
3 TRCN0000221854 GCCATCTTTAACACCTTACAA pLKO.1 3325 CDS 100% 5.625 7.875 N Adgrg2 n/a
4 TRCN0000413479 TTCAGTCTGTTGGTAAGTTTA pLKO_005 4185 3UTR 100% 13.200 10.560 N Adgrg2 n/a
5 TRCN0000436715 CTGATGGCTGTTCCGTCAAAG pLKO_005 2489 CDS 100% 10.800 8.640 N Adgrg2 n/a
6 TRCN0000221853 GCTGTATAATACCCGAGGTTT pLKO.1 2790 CDS 100% 4.950 3.960 N Adgrg2 n/a
7 TRCN0000367776 GGTTCAGCTCTGTCGAATTAA pLKO_005 3159 CDS 100% 15.000 10.500 N ADGRG2 n/a
8 TRCN0000221852 CCTCCTTTAGAAGATCATATA pLKO.1 4374 3UTR 100% 13.200 9.240 N Adgrg2 n/a
9 TRCN0000221855 GCTCTGACATTTATCACGTAT pLKO.1 2611 CDS 100% 4.950 3.465 N Adgrg2 n/a
10 TRCN0000221856 GCTTACACTTTATCGAGCAAA pLKO.1 3761 CDS 100% 4.950 3.465 N Adgrg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528806.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489195 AATCCACCTGTACGCTCATGCCCC pLX_317 12.2% 76.3% 73.9% V5 (many diffs) n/a
2 TRCN0000489489 GGGATAACATGATGAAAACTTGCC pLX_317 11.9% 76.3% 73.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV