Transcript: Mouse XM_006529226.1

PREDICTED: Mus musculus transient receptor potential cation channel, subfamily M, member 8 (Trpm8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trpm8 (171382)
Length:
3729
CDS:
62..3376

Additional Resources:

NCBI RefSeq record:
XM_006529226.1
NBCI Gene record:
Trpm8 (171382)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068711 CCGGCTCCACTCTTCTAATAA pLKO.1 2506 CDS 100% 15.000 21.000 N Trpm8 n/a
2 TRCN0000045072 CGGCTCCACTCTTCTAATAAA pLKO.1 2507 CDS 100% 15.000 21.000 N TRPM8 n/a
3 TRCN0000427234 AGATTGTGAGCAACGCCATTT pLKO_005 1266 CDS 100% 10.800 15.120 N Trpm8 n/a
4 TRCN0000068709 CCCTTCGTTGTCTTCGCTTAT pLKO.1 3101 CDS 100% 10.800 15.120 N Trpm8 n/a
5 TRCN0000413574 GACGTGGATAGTACCACATAT pLKO_005 2813 CDS 100% 13.200 9.240 N Trpm8 n/a
6 TRCN0000068708 GTACTGCTAATGACTTCTAAA pLKO.1 3465 3UTR 100% 13.200 9.240 N Trpm8 n/a
7 TRCN0000435055 GGAGTACTGCAACCGCCTAAA pLKO_005 3070 CDS 100% 10.800 7.560 N Trpm8 n/a
8 TRCN0000068710 GCCATCAACACCTCTGTCAAA pLKO.1 1004 CDS 100% 4.950 3.465 N Trpm8 n/a
9 TRCN0000068712 CCCTCTATACATCCTGGACAA pLKO.1 805 CDS 100% 4.050 2.835 N Trpm8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12538 pDONR223 100% 54.3% 58% None (many diffs) n/a
2 ccsbBroad304_12538 pLX_304 0% 54.3% 58% V5 (many diffs) n/a
3 TRCN0000470687 TTAGGGATGGAAAGTCCTTAGTTC pLX_317 15.5% 54.3% 58% V5 (many diffs) n/a
4 ccsbBroadEn_12537 pDONR223 100% 14.4% 14.6% None (many diffs) n/a
5 ccsbBroad304_12537 pLX_304 0% 14.4% 14.6% V5 (many diffs) n/a
6 TRCN0000470386 AAGAGCTGTGTTTCACCTTGACGC pLX_317 38.5% 14.4% 14.6% V5 (many diffs) n/a
7 TRCN0000488769 AGCATAAATAGTGTATAGTGGCGT pLX_317 62.3% 14.4% 14.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV