Transcript: Mouse XM_006529626.3

PREDICTED: Mus musculus dipeptidylpeptidase 10 (Dpp10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dpp10 (269109)
Length:
4758
CDS:
257..2647

Additional Resources:

NCBI RefSeq record:
XM_006529626.3
NBCI Gene record:
Dpp10 (269109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529626.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031460 GCAGTTCTTTACGACTAACAT pLKO.1 879 CDS 100% 5.625 7.875 N Dpp10 n/a
2 TRCN0000031463 CACCAGATGAACTAACAAATT pLKO.1 426 CDS 100% 13.200 10.560 N Dpp10 n/a
3 TRCN0000031462 CAGTTCTTATTGACACCGATA pLKO.1 2013 CDS 100% 4.050 3.240 N Dpp10 n/a
4 TRCN0000438367 GGCATCCAGTGTACTGCATAA pLKO_005 2365 CDS 100% 10.800 7.560 N Dpp10 n/a
5 TRCN0000427203 GCATGCCATCAAAGGAAGAAA pLKO_005 2334 CDS 100% 5.625 3.938 N Dpp10 n/a
6 TRCN0000436393 GAAGTTGTATGCCTCAGCTTT pLKO_005 2296 CDS 100% 4.950 3.465 N Dpp10 n/a
7 TRCN0000031459 GCTTCTTTATTGAGCCAAATA pLKO.1 3435 3UTR 100% 13.200 7.920 N Dpp10 n/a
8 TRCN0000031461 CCTGATGATAAATGACTCGTT pLKO.1 1015 CDS 100% 2.640 1.584 N Dpp10 n/a
9 TRCN0000046663 CGGTGGATCAATGATACAGAT pLKO.1 515 CDS 100% 4.950 6.930 N DPP10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529626.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08751 pDONR223 100% 86.9% 89.4% None (many diffs) n/a
2 ccsbBroad304_08751 pLX_304 0% 86.9% 89.4% V5 (many diffs) n/a
3 TRCN0000471905 ACTCCTGGGACCGGACATAAATCA pLX_317 1.4% 86.9% 89.4% V5 (many diffs) n/a
Download CSV