Transcript: Mouse XM_006529700.2

PREDICTED: Mus musculus solute carrier family 26, member 9 (Slc26a9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc26a9 (320718)
Length:
4849
CDS:
221..2593

Additional Resources:

NCBI RefSeq record:
XM_006529700.2
NBCI Gene record:
Slc26a9 (320718)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009920 CAGGAAATTGCGGGAGTTAAG pLKO.1 1790 CDS 100% 10.800 15.120 N Slc26a9 n/a
2 TRCN0000009918 CAACGCTCGGTACATGCACAA pLKO.1 1036 CDS 100% 4.050 5.670 N Slc26a9 n/a
3 TRCN0000296821 TCTTTACCTTCATTGACATTT pLKO_005 933 CDS 100% 13.200 9.240 N SLC26A9 n/a
4 TRCN0000009919 GCTATGATGTGGATTCTAACC pLKO.1 1299 CDS 100% 4.050 2.835 N Slc26a9 n/a
5 TRCN0000009921 AGTGGAGTCAGCTTTGTGGAT pLKO.1 2228 CDS 100% 2.640 1.848 N Slc26a9 n/a
6 TRCN0000009917 CTGACCATTCCCTCCTATACA pLKO.1 896 CDS 100% 5.625 3.375 N Slc26a9 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3865 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529700.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09411 pDONR223 100% 86.7% 89.6% None (many diffs) n/a
2 ccsbBroad304_09411 pLX_304 0% 86.7% 89.6% V5 (many diffs) n/a
3 TRCN0000476089 GGCGACATTGCGCTGAAATTTATA pLX_317 13.2% 86.7% 89.6% V5 (many diffs) n/a
Download CSV