Transcript: Mouse XM_006529794.3

PREDICTED: Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 (Ddx18), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ddx18 (66942)
Length:
2205
CDS:
282..2048

Additional Resources:

NCBI RefSeq record:
XM_006529794.3
NBCI Gene record:
Ddx18 (66942)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529794.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071086 CGTCAATGAGAACACCCTGAA pLKO.1 590 CDS 100% 4.050 3.240 N Ddx18 n/a
2 TRCN0000316378 CGTCAATGAGAACACCCTGAA pLKO_005 590 CDS 100% 4.050 3.240 N Ddx18 n/a
3 TRCN0000071083 CCTGGTCTAAAGTTTCTGATA pLKO.1 1696 CDS 100% 4.950 3.465 N Ddx18 n/a
4 TRCN0000316376 CCTGGTCTAAAGTTTCTGATA pLKO_005 1696 CDS 100% 4.950 3.465 N Ddx18 n/a
5 TRCN0000071084 GCTGACCGTATCTTGGATGTT pLKO.1 1038 CDS 100% 4.950 3.465 N Ddx18 n/a
6 TRCN0000316377 GCTGACCGTATCTTGGATGTT pLKO_005 1038 CDS 100% 4.950 3.465 N Ddx18 n/a
7 TRCN0000071087 CCTGAAGAGTTGGGTTTCCTT pLKO.1 1629 CDS 100% 3.000 2.100 N Ddx18 n/a
8 TRCN0000316446 CCTGAAGAGTTGGGTTTCCTT pLKO_005 1629 CDS 100% 3.000 2.100 N Ddx18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529794.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07324 pDONR223 100% 74% 79.8% None (many diffs) n/a
2 ccsbBroad304_07324 pLX_304 0% 74% 79.8% V5 (many diffs) n/a
3 TRCN0000479340 TTAAGGGAGGTTCCTAATAAGCGG pLX_317 22.8% 73.9% 79.7% V5 (many diffs) n/a
4 TRCN0000488316 GGGACAACGTGGCTATACCTCCAT pLX_317 15.5% 74% 79.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000487989 ACACGAGTGACATTGGTGGCGATC pLX_317 11.2% 73.9% 79.7% V5 (many diffs) n/a
Download CSV