Transcript: Mouse XM_006530406.1

PREDICTED: Mus musculus squamous cell carcinoma antigen recognized by T cells 3 (Sart3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sart3 (53890)
Length:
3473
CDS:
260..2788

Additional Resources:

NCBI RefSeq record:
XM_006530406.1
NBCI Gene record:
Sart3 (53890)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124205 GCCCGTATTCAGTTGATCTTT pLKO.1 881 CDS 100% 5.625 7.875 N Sart3 n/a
2 TRCN0000302498 GCCCGTATTCAGTTGATCTTT pLKO_005 881 CDS 100% 5.625 7.875 N Sart3 n/a
3 TRCN0000124206 CGATAGATGTTGGTCCTCCTT pLKO.1 1914 CDS 100% 2.640 3.696 N Sart3 n/a
4 TRCN0000302448 CGATAGATGTTGGTCCTCCTT pLKO_005 1914 CDS 100% 2.640 3.696 N Sart3 n/a
5 TRCN0000124207 CCAAACATTTGGCTAGAGTAT pLKO.1 395 CDS 100% 4.950 3.465 N Sart3 n/a
6 TRCN0000124208 CGCTACAGTCAGTACCTAGAT pLKO.1 947 CDS 100% 4.950 3.465 N Sart3 n/a
7 TRCN0000302449 CGCTACAGTCAGTACCTAGAT pLKO_005 947 CDS 100% 4.950 3.465 N Sart3 n/a
8 TRCN0000124204 GCGACCTTTGTTCTTAGGAAT pLKO.1 3305 3UTR 100% 4.950 3.465 N Sart3 n/a
9 TRCN0000302509 GCGACCTTTGTTCTTAGGAAT pLKO_005 3305 3UTR 100% 4.950 3.465 N Sart3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07477 pDONR223 100% 70.7% 74.9% None (many diffs) n/a
2 ccsbBroad304_07477 pLX_304 0% 70.7% 74.9% V5 (many diffs) n/a
3 TRCN0000475527 AGTTTAGGTATCGGTATTCACGTG pLX_317 9% 70.7% 74.9% V5 (many diffs) n/a
Download CSV