Transcript: Mouse XM_006530644.2

PREDICTED: Mus musculus CCCTC-binding factor (Ctcf), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ctcf (13018)
Length:
3646
CDS:
106..2343

Additional Resources:

NCBI RefSeq record:
XM_006530644.2
NBCI Gene record:
Ctcf (13018)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530644.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360495 GCGAAAGCAGCATTCCTATAT pLKO_005 1500 CDS 100% 13.200 18.480 N Ctcf n/a
2 TRCN0000360494 TGGCATGCTACGATCAGTTTC pLKO_005 2814 3UTR 100% 10.800 15.120 N Ctcf n/a
3 TRCN0000321444 TTGGTGCGGCATCGTCGTTAT pLKO_005 1141 CDS 100% 10.800 15.120 N Ctcf n/a
4 TRCN0000039022 CCGATGATATGTCACACCTTA pLKO.1 586 CDS 100% 4.950 6.930 N Ctcf n/a
5 TRCN0000039023 GCCATCATTCAGGTCGAAGAT pLKO.1 2164 CDS 100% 4.950 6.930 N Ctcf n/a
6 TRCN0000039021 CCCATTAACATAGGAGAGCTT pLKO.1 451 CDS 100% 2.640 2.112 N Ctcf n/a
7 TRCN0000321445 GGCTTTGGGAACGGCATAATT pLKO_005 2424 3UTR 100% 15.000 10.500 N Ctcf n/a
8 TRCN0000321371 GGTGCAATTGAGAACATTATA pLKO_005 2194 CDS 100% 15.000 10.500 N Ctcf n/a
9 TRCN0000360493 CAGAAAGTGAACCGATGATAT pLKO_005 575 CDS 100% 13.200 9.240 N Ctcf n/a
10 TRCN0000321373 GACTGCTGTCTGAGGTTAATG pLKO_005 836 CDS 100% 13.200 9.240 N Ctcf n/a
11 TRCN0000321370 TGGACGATACCCAGATCATAA pLKO_005 401 CDS 100% 13.200 9.240 N Ctcf n/a
12 TRCN0000014548 GCCTCTTTCTTGGCAAAGTTT pLKO.1 2850 3UTR 100% 5.625 3.938 N CTCF n/a
13 TRCN0000039020 CGGAACACAATGGCAAGACAT pLKO.1 1831 CDS 100% 4.950 3.465 N Ctcf n/a
14 TRCN0000039019 GCAGAGAAAGTAGTTGGTAAT pLKO.1 856 CDS 100% 10.800 6.480 N Ctcf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530644.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02499 pDONR223 100% 90.4% 96.7% None (many diffs) n/a
2 ccsbBroad304_02499 pLX_304 0% 90.4% 96.7% V5 (many diffs) n/a
3 TRCN0000479923 ACCACACCGTTTGGGACACATCTC pLX_317 12.6% 90.4% 96.7% V5 (many diffs) n/a
Download CSV