Transcript: Mouse XM_006530736.3

PREDICTED: Mus musculus hook microtubule tethering protein 2 (Hook2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hook2 (170833)
Length:
2825
CDS:
136..2484

Additional Resources:

NCBI RefSeq record:
XM_006530736.3
NBCI Gene record:
Hook2 (170833)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530736.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111733 CTGTGCTATCAGTTGTGAGAA pLKO.1 495 CDS 100% 4.950 3.465 N Hook2 n/a
2 TRCN0000316231 CTGTGCTATCAGTTGTGAGAA pLKO_005 495 CDS 100% 4.950 3.465 N Hook2 n/a
3 TRCN0000111731 GCCTCACAGCTAAGAAGCTAT pLKO.1 830 CDS 100% 4.950 3.465 N Hook2 n/a
4 TRCN0000349162 GCCTCACAGCTAAGAAGCTAT pLKO_005 830 CDS 100% 4.950 3.465 N Hook2 n/a
5 TRCN0000111730 GCTTCCTTAGATGGGAGAGAA pLKO.1 2579 3UTR 100% 4.950 3.465 N Hook2 n/a
6 TRCN0000316232 GCTTCCTTAGATGGGAGAGAA pLKO_005 2579 3UTR 100% 4.950 3.465 N Hook2 n/a
7 TRCN0000111734 GCTGCTTATCAGTGCCTGGTA pLKO.1 2310 CDS 100% 2.640 1.848 N Hook2 n/a
8 TRCN0000316304 GCTGCTTATCAGTGCCTGGTA pLKO_005 2310 CDS 100% 2.640 1.848 N Hook2 n/a
9 TRCN0000111732 CACCAGAGAATTACGGGAATT pLKO.1 623 CDS 100% 0.000 0.000 N Hook2 n/a
10 TRCN0000316233 CACCAGAGAATTACGGGAATT pLKO_005 623 CDS 100% 0.000 0.000 N Hook2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530736.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08137 pDONR223 100% 76.5% 78.7% None (many diffs) n/a
2 ccsbBroad304_08137 pLX_304 0% 76.5% 78.7% V5 (many diffs) n/a
3 TRCN0000474500 GTGCCTTTCCGCTCGCGTGGTTTC pLX_317 23.9% 76.5% 78.7% V5 (many diffs) n/a
Download CSV