Transcript: Mouse XM_006531655.2

PREDICTED: Mus musculus carnitine palmitoyltransferase 1a, liver (Cpt1a), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cpt1a (12894)
Length:
4650
CDS:
437..2758

Additional Resources:

NCBI RefSeq record:
XM_006531655.2
NBCI Gene record:
Cpt1a (12894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531655.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305937 CGAATCGGAACAGGGATATAG pLKO_005 1699 CDS 100% 13.200 18.480 N Cpt1a n/a
2 TRCN0000110599 GCAAAGATCAATCGGACCCTA pLKO.1 689 CDS 100% 2.640 3.696 N Cpt1a n/a
3 TRCN0000325519 GCAAAGATCAATCGGACCCTA pLKO_005 689 CDS 100% 2.640 3.696 N Cpt1a n/a
4 TRCN0000110598 GCTATGGTGTTTCCTACATTA pLKO.1 2592 CDS 100% 13.200 9.240 N Cpt1a n/a
5 TRCN0000325593 GCTATGGTGTTTCCTACATTA pLKO_005 2592 CDS 100% 13.200 9.240 N Cpt1a n/a
6 TRCN0000305935 ATGGACTCTAGTGATACAAAC pLKO_005 2783 3UTR 100% 10.800 7.560 N Cpt1a n/a
7 TRCN0000110596 GCAGTGGTATTTGAAGCTAAA pLKO.1 1087 CDS 100% 10.800 7.560 N Cpt1a n/a
8 TRCN0000110597 GCTCGCACATTACAAGGACAT pLKO.1 2161 CDS 100% 4.050 2.835 N Cpt1a n/a
9 TRCN0000325592 GCTCGCACATTACAAGGACAT pLKO_005 2161 CDS 100% 4.050 2.835 N Cpt1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531655.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00359 pDONR223 100% 79.8% 82.8% None (many diffs) n/a
2 ccsbBroad304_00359 pLX_304 0% 79.8% 82.8% V5 (many diffs) n/a
3 TRCN0000466447 ATGTGTTTGCCGCACGCTGACCGC pLX_317 19% 79.8% 82.8% V5 (many diffs) n/a
Download CSV