Transcript: Mouse XM_006533333.2

PREDICTED: Mus musculus myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6 (Mllt6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mllt6 (246198)
Length:
7259
CDS:
59..3385

Additional Resources:

NCBI RefSeq record:
XM_006533333.2
NBCI Gene record:
Mllt6 (246198)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533333.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126607 GCCTGAGTCATAAGGACAAGA pLKO.1 1017 CDS 100% 4.950 6.930 N Mllt6 n/a
2 TRCN0000126605 GCAGGCATCTATACCAGTAAT pLKO.1 1754 CDS 100% 13.200 9.240 N Mllt6 n/a
3 TRCN0000358814 AGTACTGCGGCTACTGCAAAT pLKO_005 573 CDS 100% 10.800 7.560 N MLLT6 n/a
4 TRCN0000019899 CGGCTACTGCAAATACCACTT pLKO.1 580 CDS 100% 4.050 2.835 N MLLT6 n/a
5 TRCN0000126606 CGAAAGGACAAAGAACGCCTT pLKO.1 824 CDS 100% 2.160 1.512 N Mllt6 n/a
6 TRCN0000126608 CTGAGTCATAAGGACAAGAAA pLKO.1 1019 CDS 100% 5.625 3.375 N Mllt6 n/a
7 TRCN0000126604 CCTGTCTGTCTATCTGTCATT pLKO.1 4132 3UTR 100% 4.950 2.970 N Mllt6 n/a
8 TRCN0000358813 AGCCATAGCCTGAGTCATAAA pLKO_005 1010 CDS 100% 13.200 9.240 N MLLT6 n/a
9 TRCN0000177808 CCTGGAACTTGCTATGTAGAT pLKO.1 5811 3UTR 100% 4.950 2.475 Y 2310022A10Rik n/a
10 TRCN0000286002 CCTGGAACTTGCTATGTAGAT pLKO_005 5811 3UTR 100% 4.950 2.475 Y 2310022A10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533333.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10971 pDONR223 100% 37.1% 39.4% None (many diffs) n/a
2 ccsbBroad304_10971 pLX_304 0% 37.1% 39.4% V5 (many diffs) n/a
3 TRCN0000466712 GCATATGGGCAGTAATGCTACTTC pLX_317 33.5% 37.1% 39.4% V5 (many diffs) n/a
4 ccsbBroadEn_15500 pDONR223 0% 26% 23.6% None (many diffs) n/a
5 ccsbBroad304_15500 pLX_304 0% 26% 23.6% V5 (many diffs) n/a
6 TRCN0000468129 CTAAGGAAGTGTCAACTCATCATG pLX_317 46.3% 26% 23.6% V5 (many diffs) n/a
Download CSV