Transcript: Mouse XM_006533640.3

PREDICTED: Mus musculus rabphilin 3A-like (without C2 domains) (Rph3al), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rph3al (380714)
Length:
2356
CDS:
269..1177

Additional Resources:

NCBI RefSeq record:
XM_006533640.3
NBCI Gene record:
Rph3al (380714)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533640.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115353 GCTGTGTAAGATCTGCAGTGA pLKO.1 676 CDS 100% 2.640 2.112 N Rph3al n/a
2 TRCN0000115351 CCTCCGTATTCTGCAAAGACT pLKO.1 591 CDS 100% 3.000 2.100 N Rph3al n/a
3 TRCN0000059864 CAGGAAGAAAGTCTGCACCAA pLKO.1 613 CDS 100% 2.640 1.848 N RPH3AL n/a
4 TRCN0000286500 CAGGAAGAAAGTCTGCACCAA pLKO_005 613 CDS 100% 2.640 1.848 N RPH3AL n/a
5 TRCN0000115355 CGAGGGAGAGTGGTTTCCAGT pLKO.1 872 CDS 100% 0.880 0.616 N Rph3al n/a
6 TRCN0000115352 GCAGAGGAACGTGATGGGCAA pLKO.1 517 CDS 100% 0.720 0.504 N Rph3al n/a
7 TRCN0000115354 CCACAGAAACACAGCCTCCGA pLKO.1 819 CDS 100% 0.220 0.154 N Rph3al n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533640.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02176 pDONR223 100% 80.3% 78.1% None (many diffs) n/a
2 ccsbBroad304_02176 pLX_304 0% 80.3% 78.1% V5 (many diffs) n/a
3 TRCN0000469660 GCCGCCTCGGATATTAGTTAGCCG pLX_317 31.5% 80.3% 78.1% V5 (many diffs) n/a
Download CSV