Transcript: Mouse XM_006533682.3

PREDICTED: Mus musculus misshapen-like kinase 1 (zebrafish) (Mink1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mink1 (50932)
Length:
5178
CDS:
397..4410

Additional Resources:

NCBI RefSeq record:
XM_006533682.3
NBCI Gene record:
Mink1 (50932)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146260 CACTGCCCTTAACACCAGTG pXPR_003 GGG 2140 53% 18 -0.0991 Mink1 MINK1 76260
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533682.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361713 AGGAACAAACTGCGGGTATAT pLKO_005 3646 CDS 100% 13.200 18.480 N Mink1 n/a
2 TRCN0000361638 TGTGAAATATGAACGGATTAA pLKO_005 3774 CDS 100% 13.200 18.480 N Mink1 n/a
3 TRCN0000025334 CGGATTAAGTTCCTGGTCATT pLKO.1 3787 CDS 100% 4.950 6.930 N Mink1 n/a
4 TRCN0000196775 GAACCGTAACTGCATCATGAA pLKO.1 4383 CDS 100% 4.950 6.930 N MINK1 n/a
5 TRCN0000025338 CCATCGCAATATTGCCACCTA pLKO.1 630 CDS 100% 2.640 3.696 N Mink1 n/a
6 TRCN0000361640 GCTGGGAACGTGACCTCATAT pLKO_005 4537 3UTR 100% 13.200 10.560 N Mink1 n/a
7 TRCN0000025336 CGACCTGGTAAAGAACACAAA pLKO.1 738 CDS 100% 4.950 3.960 N Mink1 n/a
8 TRCN0000284870 AGCGGCTCAAGGTCATCTATG pLKO_005 3935 CDS 100% 10.800 7.560 N MINK1 n/a
9 TRCN0000025335 CCCAGGCTCAAGTCAAAGAAA pLKO.1 1147 CDS 100% 5.625 3.938 N Mink1 n/a
10 TRCN0000025337 GCTTGCTGATAGCAATGGCTA pLKO.1 3108 CDS 100% 2.640 1.848 N Mink1 n/a
11 TRCN0000361720 CCACCGAACAGTTACTCAAAT pLKO_005 1232 CDS 100% 13.200 7.920 N Mink1 n/a
12 TRCN0000195612 CTTTCGTGATCACGTGACCAT pLKO.1 4566 3UTR 100% 2.640 1.848 N MINK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533682.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15055 pDONR223 39.3% 85.5% 18.3% None (many diffs) n/a
2 ccsbBroad304_15055 pLX_304 0% 85.5% 18.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469341 TGTTGAACGGGAACAATCATACGG pLX_317 9% 85.5% 18.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000487725 GTTAGATCCCATAGCCACAACTTC pLX_317 1% 84.3% 90.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488183 AGTGTCCGTCGATCTTTACTTGCG pLX_317 8.9% 84.3% 90.3% V5 (many diffs) n/a
6 TRCN0000488128 GTACACACAATACATGCGTTGTTC pLX_317 8.9% 84.1% 90.1% V5 (many diffs) n/a
Download CSV