Transcript: Mouse XM_006533828.2

PREDICTED: Mus musculus SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 (Smarce1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smarce1 (57376)
Length:
3040
CDS:
993..2018

Additional Resources:

NCBI RefSeq record:
XM_006533828.2
NBCI Gene record:
Smarce1 (57376)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006533828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081947 CCTGCGTACCTTGCCTATATT pLKO.1 1191 CDS 100% 15.000 12.000 N Smarce1 n/a
2 TRCN0000218577 TAATCAAGACACCCATCATTC pLKO_005 2230 3UTR 100% 10.800 7.560 N Smarce1 n/a
3 TRCN0000081943 CCCATCATTCTCTGAGAACTA pLKO.1 2241 3UTR 100% 4.950 3.465 N Smarce1 n/a
4 TRCN0000092717 GAGTCTATGAAGGCCTACCAT pLKO.1 1164 CDS 100% 3.000 2.100 N Gm8494 n/a
5 TRCN0000081946 GCATGGAGAAAGGAGAACCTT pLKO.1 1270 CDS 100% 3.000 2.100 N Smarce1 n/a
6 TRCN0000092715 GATAGAGTACAATGAGTCTAT pLKO.1 1151 CDS 100% 0.495 0.347 N Gm8494 n/a
7 TRCN0000081945 CGGTTGTCACAACAGCTAGAA pLKO.1 1432 CDS 100% 4.950 2.970 N Smarce1 n/a
8 TRCN0000157796 CGCATGGAGAAAGGAGAACAT pLKO.1 1269 CDS 100% 4.950 2.970 N FKBP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006533828.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15596 pDONR223 0% 75.7% 80.2% None (many diffs) n/a
2 ccsbBroad304_15596 pLX_304 0% 75.7% 80.2% V5 (many diffs) n/a
3 TRCN0000478729 TCACATCCAGTTTGGAGAAAGGTC pLX_317 31.7% 75.7% 80.2% V5 (many diffs) n/a
4 ccsbBroadEn_06976 pDONR223 100% 75.7% 80.2% None (many diffs) n/a
5 ccsbBroad304_06976 pLX_304 0% 75.7% 80.2% V5 (many diffs) n/a
6 TRCN0000471989 GGATACCGGTCGTCCGGTGAAGTG pLX_317 13.8% 75.7% 80.2% V5 (many diffs) n/a
Download CSV