Transcript: Mouse XM_006534789.3

PREDICTED: Mus musculus BMP2 inducible kinase (Bmp2k), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bmp2k (140780)
Length:
2272
CDS:
222..2174

Additional Resources:

NCBI RefSeq record:
XM_006534789.3
NBCI Gene record:
Bmp2k (140780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027042 CCGGTCTCCAACATCAATAAT pLKO.1 1182 CDS 100% 15.000 21.000 N Bmp2k n/a
2 TRCN0000321669 CCGGTCTCCAACATCAATAAT pLKO_005 1182 CDS 100% 15.000 21.000 N Bmp2k n/a
3 TRCN0000226438 CTTTGGCAGTGCCACTAATAA pLKO_005 806 CDS 100% 15.000 21.000 N BMP2K n/a
4 TRCN0000026972 CCCGACCTCAACATTTGTAAA pLKO.1 471 CDS 100% 13.200 18.480 N Bmp2k n/a
5 TRCN0000321671 GTATCCTACTTTGCGTTTAAA pLKO_005 1143 CDS 100% 15.000 10.500 N Bmp2k n/a
6 TRCN0000027031 CCGAGTCAGAAGTCCTACAAA pLKO.1 664 CDS 100% 5.625 3.938 N Bmp2k n/a
7 TRCN0000321668 CCGAGTCAGAAGTCCTACAAA pLKO_005 664 CDS 100% 5.625 3.938 N Bmp2k n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534789.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492092 CCCCCGATGGCCCGCTTATCCTAC pLX_317 20.5% 85.5% 87.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15104 pDONR223 76.2% 84.3% 57.9% None (many diffs) n/a
3 ccsbBroad304_15104 pLX_304 0% 84.3% 57.9% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000474847 ATTTAGCCGTGCCCAGATTTCCAA pLX_317 21% 84.3% 57.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV