Transcript: Mouse XM_006535631.2

PREDICTED: Mus musculus 5-hydroxytryptamine (serotonin) receptor 5A (Htr5a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Htr5a (15563)
Length:
3328
CDS:
129..1271

Additional Resources:

NCBI RefSeq record:
XM_006535631.2
NBCI Gene record:
Htr5a (15563)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535631.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026281 CGAGCCTTCCTACACCGTGTT pLKO.1 785 CDS 100% 1.350 1.890 N Htr5a n/a
2 TRCN0000026298 GCGTGTCTCCAATGTGATGAT pLKO.1 662 CDS 100% 4.950 3.960 N Htr5a n/a
3 TRCN0000426093 TTGTAGCTCAGTGGGTTATAT pLKO_005 1304 3UTR 100% 15.000 10.500 N Htr5a n/a
4 TRCN0000433532 CTCTGGCTCCACTGCTATTTG pLKO_005 715 CDS 100% 13.200 9.240 N Htr5a n/a
5 TRCN0000026280 CCTGTGGTTGGGCTATTCTAA pLKO.1 1166 CDS 100% 5.625 3.938 N Htr5a n/a
6 TRCN0000026324 CCCACTCATCTACACAGCATT pLKO.1 1199 CDS 100% 4.950 3.465 N Htr5a n/a
7 TRCN0000026292 GCATCTGGAATGTGACAGCAA pLKO.1 580 CDS 100% 2.640 1.848 N Htr5a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535631.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06419 pDONR223 100% 78.2% 77.3% None (many diffs) n/a
2 ccsbBroad304_06419 pLX_304 0% 78.2% 77.3% V5 (many diffs) n/a
3 TRCN0000475616 CTCTACGGTGATGGTACCTGATTG pLX_317 25.6% 78.2% 77.3% V5 (many diffs) n/a
Download CSV