Transcript: Mouse XM_006535651.3

PREDICTED: Mus musculus solute carrier family 4 (anion exchanger), member 2 (Slc4a2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc4a2 (20535)
Length:
4312
CDS:
404..4117

Additional Resources:

NCBI RefSeq record:
XM_006535651.3
NBCI Gene record:
Slc4a2 (20535)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535651.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069832 GCCTGGACATCGAAGTTACAA pLKO.1 1072 CDS 100% 5.625 7.875 N Slc4a2 n/a
2 TRCN0000069829 CGAGACCTTCTATAAGCTGAT pLKO.1 2902 CDS 100% 4.050 2.835 N Slc4a2 n/a
3 TRCN0000069830 GCAGTTCAGTTCTTTCTCCAA pLKO.1 854 CDS 100% 2.640 1.848 N Slc4a2 n/a
4 TRCN0000069831 GCTGACTGCTATCAATGCCTT pLKO.1 2185 CDS 100% 2.640 1.848 N Slc4a2 n/a
5 TRCN0000069828 CCAGTGTTTGACGAGTGTGAA pLKO.1 4058 CDS 100% 4.950 2.970 N Slc4a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535651.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13954 pDONR223 100% 81.5% 87.7% None (many diffs) n/a
2 ccsbBroad304_13954 pLX_304 0% 81.5% 87.7% V5 (many diffs) n/a
3 TRCN0000478220 ACCCCAAGGGTATTCATAAGTGTC pLX_317 7.2% 81.5% 87.7% V5 (many diffs) n/a
4 ccsbBroadEn_15593 pDONR223 0% 77% 81.6% None (many diffs) n/a
5 ccsbBroad304_15593 pLX_304 0% 77% 81.6% V5 (many diffs) n/a
Download CSV