Transcript: Mouse XM_006537616.2

PREDICTED: Mus musculus gamma-aminobutyric acid (GABA) C receptor, subunit rho 2 (Gabrr2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gabrr2 (14409)
Length:
2463
CDS:
888..2183

Additional Resources:

NCBI RefSeq record:
XM_006537616.2
NBCI Gene record:
Gabrr2 (14409)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415392 CATGTGTGGAATGCTTCATTC pLKO_005 1880 CDS 100% 10.800 15.120 N GABRR2 n/a
2 TRCN0000102975 TGGTGGATACATGGACCTAAT pLKO.1 2225 3UTR 100% 10.800 7.560 N Gabrr2 n/a
3 TRCN0000102977 CCTAATTTATTGGTCAGTGTT pLKO.1 2156 CDS 100% 4.950 3.465 N Gabrr2 n/a
4 TRCN0000102978 CAGGTTGATATTTCCTGCCTT pLKO.1 2120 CDS 100% 2.640 1.848 N Gabrr2 n/a
5 TRCN0000102949 GCGTCGTCACATCTTCTTCTT pLKO.1 1556 CDS 100% 4.950 2.475 Y Gabrr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10835 pDONR223 100% 81% 84% None (many diffs) n/a
2 ccsbBroad304_10835 pLX_304 0% 81% 84% V5 (many diffs) n/a
3 TRCN0000472128 CTTCGTCCATTCGGTGCTGCAGGT pLX_317 11.9% 81% 84% V5 (many diffs) n/a
Download CSV