Transcript: Mouse XM_006538234.1

PREDICTED: Mus musculus N-terminal EF-hand calcium binding protein 1 (Necab1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Necab1 (69352)
Length:
4829
CDS:
51..1181

Additional Resources:

NCBI RefSeq record:
XM_006538234.1
NBCI Gene record:
Necab1 (69352)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538234.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120001 CTCAAACGAATCTCGCTACAT pLKO.1 1001 CDS 100% 4.950 6.930 N Necab1 n/a
2 TRCN0000119997 CCTCCAACTATTTGCTTTATA pLKO.1 1777 3UTR 100% 15.000 10.500 N Necab1 n/a
3 TRCN0000119998 CCAGTGGATGACCCAGATAAA pLKO.1 758 CDS 100% 13.200 9.240 N Necab1 n/a
4 TRCN0000120000 GCTTCCAATTTGGAACAATTT pLKO.1 492 CDS 100% 13.200 9.240 N Necab1 n/a
5 TRCN0000119999 CCACACCATTGACACACACAA pLKO.1 329 CDS 100% 4.950 3.465 N Necab1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538234.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08841 pDONR223 100% 85% 89.8% None (many diffs) n/a
2 ccsbBroad304_08841 pLX_304 0% 85% 89.8% V5 (many diffs) n/a
3 TRCN0000477239 CCTTTAATGATATTGGAATTCTGT pLX_317 42.1% 85% 89.8% V5 (many diffs) n/a
4 ccsbBroadEn_12453 pDONR223 100% 24% 25.7% None (many diffs) n/a
5 ccsbBroad304_12453 pLX_304 0% 24% 25.7% V5 (many diffs) n/a
6 TRCN0000466218 TTCTTAGGTGGAGGGTGAGCGTAC pLX_317 100% 24% 25.7% V5 (many diffs) n/a
Download CSV