Transcript: Mouse XM_006538249.2

PREDICTED: Mus musculus pre-mRNA processing factor 4 (Prpf4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prpf4 (70052)
Length:
2266
CDS:
107..946

Additional Resources:

NCBI RefSeq record:
XM_006538249.2
NBCI Gene record:
Prpf4 (70052)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538249.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364756 ATGACCGTTCATGGCGCTTAT pLKO_005 405 CDS 100% 10.800 15.120 N PRPF4 n/a
2 TRCN0000109063 CGAGGCCATAACACAAATGTA pLKO.1 185 CDS 100% 5.625 7.875 N Prpf4 n/a
3 TRCN0000364700 ATGAACCAGTGGCAGATATTG pLKO_005 315 CDS 100% 13.200 9.240 N PRPF4 n/a
4 TRCN0000109062 CGCTGCATTATGTTCCTGGAA pLKO.1 569 CDS 100% 2.640 1.848 N Prpf4 n/a
5 TRCN0000109060 CGAGAATGAAACCAGAGCCAT pLKO.1 1692 3UTR 100% 2.640 1.584 N Prpf4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538249.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11339 pDONR223 100% 48.5% 51.7% None (many diffs) n/a
2 ccsbBroad304_11339 pLX_304 0% 48.5% 51.7% V5 (many diffs) n/a
3 TRCN0000478206 TCCATAGACGACGTCGATTACTTT pLX_317 17.1% 48.5% 51.7% V5 (many diffs) n/a
4 ccsbBroadEn_02087 pDONR223 100% 48.5% 51.6% None (many diffs) n/a
5 ccsbBroad304_02087 pLX_304 0% 48.5% 51.6% V5 (many diffs) n/a
6 TRCN0000479729 TAGCGTTGGACCCATTGGCTGGAC pLX_317 22.8% 48.5% 51.6% V5 (many diffs) n/a
Download CSV