Transcript: Mouse XM_006538538.3

PREDICTED: Mus musculus EYA transcriptional coactivator and phosphatase 3 (Eya3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eya3 (14050)
Length:
5369
CDS:
293..1963

Additional Resources:

NCBI RefSeq record:
XM_006538538.3
NBCI Gene record:
Eya3 (14050)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538538.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029858 CCCTCGCTCATCCAATGATTA pLKO.1 424 CDS 100% 13.200 18.480 N Eya3 n/a
2 TRCN0000231182 CCCTCGCTCATCCAATGATTA pLKO_005 424 CDS 100% 13.200 18.480 N Eya3 n/a
3 TRCN0000231183 GATTATCCCACCTATACTATT pLKO_005 830 CDS 100% 13.200 18.480 N Eya3 n/a
4 TRCN0000231184 AGTGAATTGGAACGGGTATTT pLKO_005 1139 CDS 100% 13.200 10.560 N Eya3 n/a
5 TRCN0000231181 ACATCCAGCCTTGCGTCAAAT pLKO_005 362 CDS 100% 13.200 9.240 N Eya3 n/a
6 TRCN0000029854 CGTGTAAGAAACACTCATAAA pLKO.1 4302 3UTR 100% 13.200 9.240 N Eya3 n/a
7 TRCN0000231185 CTGGACAACGCCACCTATTAG pLKO_005 3798 3UTR 100% 13.200 9.240 N Eya3 n/a
8 TRCN0000029855 CCAATGATTATACCTCACAAA pLKO.1 435 CDS 100% 4.950 3.465 N Eya3 n/a
9 TRCN0000029856 CCACAACATTAGCAGCTACAA pLKO.1 930 CDS 100% 4.950 3.465 N Eya3 n/a
10 TRCN0000029857 CCAGGCTTTAGAGCTTGACTT pLKO.1 1936 CDS 100% 4.950 3.465 N Eya3 n/a
11 TRCN0000051606 GCACATTATTCTTATCCCATT pLKO.1 719 CDS 100% 4.050 2.430 N EYA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538538.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491915 CCGTCATCTACTAAGTACAGCCCC pLX_317 23.9% 77.5% 76.4% V5 (many diffs) n/a
2 ccsbBroadEn_10815 pDONR223 100% 77.4% 76.4% None (many diffs) n/a
3 ccsbBroad304_10815 pLX_304 0% 77.4% 76.4% V5 (many diffs) n/a
4 TRCN0000467722 GACCTGGTTTTCTGTAAATTCGCG pLX_317 23.4% 77.4% 76.4% V5 (many diffs) n/a
5 TRCN0000489799 TACGGGGGAAATTGGTGCTGCGTT pLX_317 22.1% 77.4% 76.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV