Transcript: Mouse XM_006538911.3

PREDICTED: Mus musculus erythrocyte membrane protein band 4.1 (Epb41), transcript variant X18, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Epb41 (269587)
Length:
5332
CDS:
16..2805

Additional Resources:

NCBI RefSeq record:
XM_006538911.3
NBCI Gene record:
Epb41 (269587)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538911.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091161 CCGAGACCACAAGTAGTACAA pLKO.1 2585 CDS 100% 4.950 6.930 N Epb41 n/a
2 TRCN0000303177 CCGAGACCACAAGTAGTACAA pLKO_005 2585 CDS 100% 4.950 6.930 N Epb41 n/a
3 TRCN0000091160 GCTCCAAATCAGACCAAGGAA pLKO.1 1459 CDS 100% 3.000 4.200 N Epb41 n/a
4 TRCN0000315476 GCTCCAAATCAGACCAAGGAA pLKO_005 1459 CDS 100% 3.000 4.200 N Epb41 n/a
5 TRCN0000091159 CCAACCAAAGATGTCCCTATT pLKO.1 2461 CDS 100% 10.800 7.560 N Epb41 n/a
6 TRCN0000303166 CCAACCAAAGATGTCCCTATT pLKO_005 2461 CDS 100% 10.800 7.560 N Epb41 n/a
7 TRCN0000091158 CCTCTGTAATCCTCCAGCTAA pLKO.1 4046 3UTR 100% 4.950 3.465 N Epb41 n/a
8 TRCN0000091162 GATCGAGAAGAGAATTGTGAT pLKO.1 2655 CDS 100% 4.950 3.465 N Epb41 n/a
9 TRCN0000303240 GATCGAGAAGAGAATTGTGAT pLKO_005 2655 CDS 100% 4.950 3.465 N Epb41 n/a
10 TRCN0000083546 CCTCTAAGACATGGCTGGATT pLKO.1 1172 CDS 100% 4.950 2.970 N EPB41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538911.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10801 pDONR223 100% 55.2% 58.7% None (many diffs) n/a
2 ccsbBroad304_10801 pLX_304 0% 55.2% 58.7% V5 (many diffs) n/a
Download CSV