Transcript: Mouse XM_006539753.3

PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 3 (Cnot3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnot3 (232791)
Length:
2879
CDS:
347..2605

Additional Resources:

NCBI RefSeq record:
XM_006539753.3
NBCI Gene record:
Cnot3 (232791)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539753.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095858 CCAACGTTACACCTAACTGAT pLKO.1 2024 CDS 100% 4.950 6.930 N Cnot3 n/a
2 TRCN0000323577 CCAACGTTACACCTAACTGAT pLKO_005 2024 CDS 100% 4.950 6.930 N Cnot3 n/a
3 TRCN0000015136 CAGGGCACCTACATCTACTTT pLKO.1 2504 CDS 100% 5.625 4.500 N CNOT3 n/a
4 TRCN0000015137 TGGAGCAGTTTGAAGATATTT pLKO.1 411 CDS 100% 15.000 10.500 N CNOT3 n/a
5 TRCN0000095857 GCGATTCCACACCAAGTATAT pLKO.1 2431 CDS 100% 13.200 9.240 N Cnot3 n/a
6 TRCN0000323580 GCGATTCCACACCAAGTATAT pLKO_005 2431 CDS 100% 13.200 9.240 N Cnot3 n/a
7 TRCN0000419474 AGCTGTCAGAGGTGAACATAC pLKO_005 2103 CDS 100% 10.800 7.560 N CNOT3 n/a
8 TRCN0000095855 GCAAGCTCATTGAGACGCAAA pLKO.1 588 CDS 100% 4.050 2.835 N Cnot3 n/a
9 TRCN0000323578 GCAAGCTCATTGAGACGCAAA pLKO_005 588 CDS 100% 4.050 2.835 N Cnot3 n/a
10 TRCN0000095856 CCCGACTTTGAAGAGAACGAA pLKO.1 998 CDS 100% 3.000 2.100 N Cnot3 n/a
11 TRCN0000323579 CCCGACTTTGAAGAGAACGAA pLKO_005 998 CDS 100% 3.000 2.100 N Cnot3 n/a
12 TRCN0000095854 CCCAGGAAGCAGGGAAGGGAT pLKO.1 2716 3UTR 100% 0.000 0.000 N Cnot3 n/a
13 TRCN0000015133 GCCCTGCCCTGGAAGACTGGA pLKO.1 2665 3UTR 100% 0.000 0.000 N CNOT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539753.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06648 pDONR223 100% 90.8% 95% None (many diffs) n/a
2 ccsbBroad304_06648 pLX_304 0% 90.8% 95% V5 (many diffs) n/a
3 TRCN0000474579 TTCGTTGTACTGGATTTCGGACTC pLX_317 22.5% 90.8% 95% V5 (many diffs) n/a
Download CSV