Transcript: Mouse XM_006539823.3

PREDICTED: Mus musculus kinesin light chain 3 (Klc3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klc3 (232943)
Length:
2309
CDS:
27..2108

Additional Resources:

NCBI RefSeq record:
XM_006539823.3
NBCI Gene record:
Klc3 (232943)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539823.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100704 ACTCGTGTACAGGGACCAGAA pLKO.1 1193 CDS 100% 4.050 5.670 N Klc3 n/a
2 TRCN0000100702 CCTGGCTGTCCTCTATGGAAA pLKO.1 1313 CDS 100% 4.950 3.465 N Klc3 n/a
3 TRCN0000100700 CAGCTTCTCAAGGATCAGGAA pLKO.1 2130 3UTR 100% 2.640 1.848 N Klc3 n/a
4 TRCN0000100703 CGGCAGACACGACAGGTTGTA pLKO.1 498 CDS 100% 1.650 1.155 N Klc3 n/a
5 TRCN0000100701 GCCCAAGAGAACACATGGCTT pLKO.1 762 CDS 100% 2.640 1.584 N Klc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539823.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13241 pDONR223 100% 62.7% 65.5% None (many diffs) n/a
2 ccsbBroad304_13241 pLX_304 0% 62.7% 65.5% V5 (many diffs) n/a
3 TRCN0000467515 TAATACGATGCACAGACCATATCG pLX_317 21% 62.7% 65.5% V5 (many diffs) n/a
4 ccsbBroadEn_09649 pDONR223 100% 62.7% 65.3% None (many diffs) n/a
5 ccsbBroad304_09649 pLX_304 0% 62.7% 65.3% V5 (many diffs) n/a
6 TRCN0000472064 CCGCACGATGCGTTCACTTAATAT pLX_317 24.5% 62.7% 65.3% V5 (many diffs) n/a
Download CSV