Transcript: Mouse XM_006540636.3

PREDICTED: Mus musculus general transcription factor II H, polypeptide 1 (Gtf2h1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gtf2h1 (14884)
Length:
2711
CDS:
159..1820

Additional Resources:

NCBI RefSeq record:
XM_006540636.3
NBCI Gene record:
Gtf2h1 (14884)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540636.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315385 ATTCTGGGCCAATCGTTTAAA pLKO_005 599 CDS 100% 15.000 21.000 N GTF2H1 n/a
2 TRCN0000295598 CAGATGGTGCCAAACGATATT pLKO_005 1524 CDS 100% 13.200 18.480 N Gtf2h1 n/a
3 TRCN0000085939 CCGACTAAATACAGGATCGAA pLKO.1 872 CDS 100% 3.000 4.200 N Gtf2h1 n/a
4 TRCN0000085941 CCTGTTAATACACCATTCCTA pLKO.1 1611 CDS 100% 3.000 4.200 N Gtf2h1 n/a
5 TRCN0000295596 ATGAGCTAAGTTGCAAATATA pLKO_005 2045 3UTR 100% 15.000 12.000 N Gtf2h1 n/a
6 TRCN0000085942 GCCAATCGTTTAAATGTGAAT pLKO.1 606 CDS 100% 4.950 3.960 N Gtf2h1 n/a
7 TRCN0000288317 GCCAATCGTTTAAATGTGAAT pLKO_005 606 CDS 100% 4.950 3.960 N Gtf2h1 n/a
8 TRCN0000295643 AGAAGACGTGAAGCGTTTATG pLKO_005 1810 CDS 100% 13.200 9.240 N Gtf2h1 n/a
9 TRCN0000295646 TAGACGAGGGCTATGGCATTT pLKO_005 1003 CDS 100% 10.800 7.560 N Gtf2h1 n/a
10 TRCN0000085938 GCATGTTAAAGAGAGTGCTTT pLKO.1 2346 3UTR 100% 4.950 3.465 N Gtf2h1 n/a
11 TRCN0000006068 GTCCATTGAATATGAAGACTT pLKO.1 1241 CDS 100% 4.950 3.465 N GTF2H1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540636.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14662 pDONR223 99.2% 89.6% 42.5% None (many diffs) n/a
2 ccsbBroad304_14662 pLX_304 0% 89.6% 42.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469991 GAACACTGGTACGACCTCTTACCG pLX_317 22.2% 89.6% 42.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV