Transcript: Human XM_006710449.3

PREDICTED: Homo sapiens EYA transcriptional coactivator and phosphatase 3 (EYA3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EYA3 (2140)
Length:
6062
CDS:
213..1940

Additional Resources:

NCBI RefSeq record:
XM_006710449.3
NBCI Gene record:
EYA3 (2140)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710449.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051604 CCAGGCTTTAGAGCTTGATTT pLKO.1 1913 CDS 100% 13.200 18.480 N EYA3 n/a
2 TRCN0000051606 GCACATTATTCTTATCCCATT pLKO.1 693 CDS 100% 4.050 5.670 N EYA3 n/a
3 TRCN0000051603 CCCTTCTACAAGTCCATCTTT pLKO.1 992 CDS 100% 5.625 4.500 N EYA3 n/a
4 TRCN0000029858 CCCTCGCTCATCCAATGATTA pLKO.1 398 CDS 100% 13.200 9.240 N Eya3 n/a
5 TRCN0000231182 CCCTCGCTCATCCAATGATTA pLKO_005 398 CDS 100% 13.200 9.240 N Eya3 n/a
6 TRCN0000051607 CCTGGTTAGGAACTGCATTAA pLKO.1 1591 CDS 100% 13.200 9.240 N EYA3 n/a
7 TRCN0000231183 GATTATCCCACCTATACTATT pLKO_005 804 CDS 100% 13.200 9.240 N Eya3 n/a
8 TRCN0000051605 CCGGAAAGTGAGAGAAATCTA pLKO.1 1475 CDS 100% 5.625 3.938 N EYA3 n/a
9 TRCN0000029855 CCAATGATTATACCTCACAAA pLKO.1 409 CDS 100% 4.950 3.465 N Eya3 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5052 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5052 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710449.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10815 pDONR223 100% 88.4% 83.3% None (many diffs) n/a
2 ccsbBroad304_10815 pLX_304 0% 88.4% 83.3% V5 (many diffs) n/a
3 TRCN0000467722 GACCTGGTTTTCTGTAAATTCGCG pLX_317 23.4% 88.4% 83.3% V5 (many diffs) n/a
4 TRCN0000489799 TACGGGGGAAATTGGTGCTGCGTT pLX_317 22.1% 88.4% 83.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491915 CCGTCATCTACTAAGTACAGCCCC pLX_317 23.9% 88.3% 83.3% V5 (many diffs) n/a
Download CSV