Transcript: Human XM_006710802.2

PREDICTED: Homo sapiens ATP binding cassette subfamily D member 3 (ABCD3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCD3 (5825)
Length:
3979
CDS:
394..2445

Additional Resources:

NCBI RefSeq record:
XM_006710802.2
NBCI Gene record:
ABCD3 (5825)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710802.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293931 CATTGCATAACAGCGTTTATT pLKO_005 2933 3UTR 100% 15.000 21.000 N ABCD3 n/a
2 TRCN0000293932 TTCGAGATCAAGTGATATATC pLKO_005 2021 CDS 100% 13.200 18.480 N ABCD3 n/a
3 TRCN0000059850 GCCAAATACCTTGCCACTGTT pLKO.1 1426 CDS 100% 4.950 6.930 N ABCD3 n/a
4 TRCN0000313758 ACTGGTGGAACACCTACATAA pLKO_005 1359 CDS 100% 13.200 10.560 N Abcd3 n/a
5 TRCN0000059848 CCATTACAGAACAATGAGAAA pLKO.1 595 CDS 100% 4.950 3.960 N ABCD3 n/a
6 TRCN0000286497 CCATTACAGAACAATGAGAAA pLKO_005 595 CDS 100% 4.950 3.960 N ABCD3 n/a
7 TRCN0000059851 CGACATCTCAAGAGTACACAT pLKO.1 1495 CDS 100% 4.950 3.960 N ABCD3 n/a
8 TRCN0000286496 CGACATCTCAAGAGTACACAT pLKO_005 1495 CDS 100% 4.950 3.960 N ABCD3 n/a
9 TRCN0000313757 TTCTTGAAGTATGGGTTAAAT pLKO_005 889 CDS 100% 15.000 10.500 N Abcd3 n/a
10 TRCN0000059852 CTTGGTACTTATTGCTGTTAT pLKO.1 720 CDS 100% 13.200 9.240 N ABCD3 n/a
11 TRCN0000286495 CTTGGTACTTATTGCTGTTAT pLKO_005 720 CDS 100% 13.200 9.240 N ABCD3 n/a
12 TRCN0000105336 GCCTCTTATCTCTCTGGTTAA pLKO.1 864 CDS 100% 10.800 7.560 N Abcd3 n/a
13 TRCN0000059849 GCTGCGGAAAGAGTTCACTTT pLKO.1 1892 CDS 100% 4.950 3.465 N ABCD3 n/a
14 TRCN0000105339 CTCTTATCTCTCTGGTTAATA pLKO.1 866 CDS 100% 15.000 9.000 N Abcd3 n/a
15 TRCN0000317345 CTCTTATCTCTCTGGTTAATA pLKO_005 866 CDS 100% 15.000 9.000 N Abcd3 n/a
16 TRCN0000105338 CCATTGGTAAGATGACAATTA pLKO.1 1214 CDS 100% 13.200 9.240 N Abcd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710802.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15556 pDONR223 0% 34% 33.3% None (many diffs) n/a
2 ccsbBroad304_15556 pLX_304 0% 34% 33.3% V5 (many diffs) n/a
3 TRCN0000470789 AGCCACCCTCGGCCAACCTCGCGA pLX_317 66% 34% 33.3% V5 (many diffs) n/a
Download CSV