Transcript: Human XM_006711036.2

PREDICTED: Homo sapiens dehydrogenase/reductase 3 (DHRS3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DHRS3 (9249)
Length:
1325
CDS:
346..906

Additional Resources:

NCBI RefSeq record:
XM_006711036.2
NBCI Gene record:
DHRS3 (9249)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036533 GTTCCCTCTACAGATGATCTA pLKO.1 378 CDS 100% 4.950 3.960 N DHRS3 n/a
2 TRCN0000036529 GCACAGGACTGATGGGTATAA pLKO.1 1059 3UTR 100% 13.200 9.240 N DHRS3 n/a
3 TRCN0000290812 GCACAGGACTGATGGGTATAA pLKO_005 1059 3UTR 100% 13.200 9.240 N DHRS3 n/a
4 TRCN0000036532 ACCTGCATGAACACTTTCAAA pLKO.1 863 CDS 100% 5.625 3.938 N DHRS3 n/a
5 TRCN0000290810 ACCTGCATGAACACTTTCAAA pLKO_005 863 CDS 100% 5.625 3.938 N DHRS3 n/a
6 TRCN0000036531 CCGGACTGAGAAATGCCTGAA pLKO.1 555 CDS 100% 4.050 2.835 N DHRS3 n/a
7 TRCN0000290811 CCGGACTGAGAAATGCCTGAA pLKO_005 555 CDS 100% 4.050 2.835 N DHRS3 n/a
8 TRCN0000036530 CCACAAATTCTCAGGAACCTA pLKO.1 841 CDS 100% 3.000 2.100 N DHRS3 n/a
9 TRCN0000290886 CCACAAATTCTCAGGAACCTA pLKO_005 841 CDS 100% 3.000 2.100 N DHRS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711036.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07379 pDONR223 100% 59.6% 37.2% None 337_338ins359;548_558del n/a
2 ccsbBroad304_07379 pLX_304 0% 59.6% 37.2% V5 337_338ins359;548_558del n/a
3 TRCN0000480411 CGGCCAGTATTTACATAGGTATCG pLX_317 40.2% 59.6% 37.2% V5 337_338ins359;548_558del n/a
Download CSV